From: Sergey Bronnikov via Tarantool-patches <tarantool-patches@dev.tarantool.org>
To: Sergey Kaplun <skaplun@tarantool.org>
Cc: tarantool-patches@dev.tarantool.org
Subject: Re: [Tarantool-patches] [PATCH v2 luajit 01/41] perf: add LuaJIT-test-cleanup perf suite
Date: Mon, 29 Dec 2025 16:28:41 +0300 [thread overview]
Message-ID: <ffda497d-fe6d-4a56-a833-ff8c1502ea85@tarantool.org> (raw)
In-Reply-To: <d130aa26e0435afd2c0bf41eef5351a95dc6b771.1766738771.git.skaplun@tarantool.org>
[-- Attachment #1: Type: text/plain, Size: 95954 bytes --]
Hi, Sergey!
Thanks for the patch! LGTM
Sergey
On 12/26/25 12:17, Sergey Kaplun wrote:
> This patch introduces the LuaJIT-test-cleanup benchmark suite [1] into
> our LuaJIT fork source tree. To provide reliable reproducible results
> several benchmarks need to be adjusted. However, to be sure we initially
> use the valid suite, everything in the <perf/LuaJIT-benches> directory
> is moved intact.
>
> [1]:https://github.com/LuaJIT/LuaJIT-test-cleanup/tree/014708b/bench
> ---
> .luacheckrc | 1 +
> perf/LuaJIT-benches/PARAM_arm.txt | 29 +
> perf/LuaJIT-benches/PARAM_mips.txt | 29 +
> perf/LuaJIT-benches/PARAM_ppc.txt | 29 +
> perf/LuaJIT-benches/PARAM_x86.txt | 29 +
> perf/LuaJIT-benches/SUMCOL_1.txt | 1000 ++++++++++++++++++++
> perf/LuaJIT-benches/TEST_md5sum.txt | 20 +
> perf/LuaJIT-benches/array3d.lua | 59 ++
> perf/LuaJIT-benches/binary-trees.lua | 47 +
> perf/LuaJIT-benches/chameneos.lua | 68 ++
> perf/LuaJIT-benches/coroutine-ring.lua | 42 +
> perf/LuaJIT-benches/euler14-bit.lua | 22 +
> perf/LuaJIT-benches/fannkuch.lua | 50 +
> perf/LuaJIT-benches/fasta.lua | 95 ++
> perf/LuaJIT-benches/k-nucleotide.lua | 58 ++
> perf/LuaJIT-benches/life.lua | 111 +++
> perf/LuaJIT-benches/mandelbrot-bit.lua | 33 +
> perf/LuaJIT-benches/mandelbrot.lua | 23 +
> perf/LuaJIT-benches/md5.lua | 183 ++++
> perf/LuaJIT-benches/meteor.lua | 220 +++++
> perf/LuaJIT-benches/nbody.lua | 119 +++
> perf/LuaJIT-benches/nsieve-bit-fp.lua | 37 +
> perf/LuaJIT-benches/nsieve-bit.lua | 27 +
> perf/LuaJIT-benches/nsieve.lua | 21 +
> perf/LuaJIT-benches/partialsums.lua | 29 +
> perf/LuaJIT-benches/pidigits-nogmp.lua | 100 ++
> perf/LuaJIT-benches/ray.lua | 135 +++
> perf/LuaJIT-benches/recursive-ack.lua | 8 +
> perf/LuaJIT-benches/recursive-fib.lua | 7 +
> perf/LuaJIT-benches/revcomp.lua | 37 +
> perf/LuaJIT-benches/scimark-2010-12-20.lua | 400 ++++++++
> perf/LuaJIT-benches/scimark-fft.lua | 1 +
> perf/LuaJIT-benches/scimark-lu.lua | 1 +
> perf/LuaJIT-benches/scimark-sor.lua | 1 +
> perf/LuaJIT-benches/scimark-sparse.lua | 1 +
> perf/LuaJIT-benches/scimark_lib.lua | 297 ++++++
> perf/LuaJIT-benches/series.lua | 34 +
> perf/LuaJIT-benches/spectral-norm.lua | 40 +
> perf/LuaJIT-benches/sum-file.lua | 6 +
> 39 files changed, 3449 insertions(+)
> create mode 100644 perf/LuaJIT-benches/PARAM_arm.txt
> create mode 100644 perf/LuaJIT-benches/PARAM_mips.txt
> create mode 100644 perf/LuaJIT-benches/PARAM_ppc.txt
> create mode 100644 perf/LuaJIT-benches/PARAM_x86.txt
> create mode 100644 perf/LuaJIT-benches/SUMCOL_1.txt
> create mode 100644 perf/LuaJIT-benches/TEST_md5sum.txt
> create mode 100644 perf/LuaJIT-benches/array3d.lua
> create mode 100644 perf/LuaJIT-benches/binary-trees.lua
> create mode 100644 perf/LuaJIT-benches/chameneos.lua
> create mode 100644 perf/LuaJIT-benches/coroutine-ring.lua
> create mode 100644 perf/LuaJIT-benches/euler14-bit.lua
> create mode 100644 perf/LuaJIT-benches/fannkuch.lua
> create mode 100644 perf/LuaJIT-benches/fasta.lua
> create mode 100644 perf/LuaJIT-benches/k-nucleotide.lua
> create mode 100644 perf/LuaJIT-benches/life.lua
> create mode 100644 perf/LuaJIT-benches/mandelbrot-bit.lua
> create mode 100644 perf/LuaJIT-benches/mandelbrot.lua
> create mode 100644 perf/LuaJIT-benches/md5.lua
> create mode 100644 perf/LuaJIT-benches/meteor.lua
> create mode 100644 perf/LuaJIT-benches/nbody.lua
> create mode 100644 perf/LuaJIT-benches/nsieve-bit-fp.lua
> create mode 100644 perf/LuaJIT-benches/nsieve-bit.lua
> create mode 100644 perf/LuaJIT-benches/nsieve.lua
> create mode 100644 perf/LuaJIT-benches/partialsums.lua
> create mode 100644 perf/LuaJIT-benches/pidigits-nogmp.lua
> create mode 100644 perf/LuaJIT-benches/ray.lua
> create mode 100644 perf/LuaJIT-benches/recursive-ack.lua
> create mode 100644 perf/LuaJIT-benches/recursive-fib.lua
> create mode 100644 perf/LuaJIT-benches/revcomp.lua
> create mode 100644 perf/LuaJIT-benches/scimark-2010-12-20.lua
> create mode 100644 perf/LuaJIT-benches/scimark-fft.lua
> create mode 100644 perf/LuaJIT-benches/scimark-lu.lua
> create mode 100644 perf/LuaJIT-benches/scimark-sor.lua
> create mode 100644 perf/LuaJIT-benches/scimark-sparse.lua
> create mode 100644 perf/LuaJIT-benches/scimark_lib.lua
> create mode 100644 perf/LuaJIT-benches/series.lua
> create mode 100644 perf/LuaJIT-benches/spectral-norm.lua
> create mode 100644 perf/LuaJIT-benches/sum-file.lua
>
> diff --git a/.luacheckrc b/.luacheckrc
> index 19098dd9..35824875 100644
> --- a/.luacheckrc
> +++ b/.luacheckrc
> @@ -16,6 +16,7 @@ files['test/tarantool-tests/'] = {
> -- test suites and need to be coherent with the upstream.
> exclude_files = {
> 'dynasm/',
> + 'perf/LuaJIT-benches/',
> 'src/',
> 'test/LuaJIT-tests/',
> 'test/PUC-Rio-Lua-5.1-tests/',
> diff --git a/perf/LuaJIT-benches/PARAM_arm.txt b/perf/LuaJIT-benches/PARAM_arm.txt
> new file mode 100644
> index 00000000..a07fd010
> --- /dev/null
> +++ b/perf/LuaJIT-benches/PARAM_arm.txt
> @@ -0,0 +1,29 @@
> +array3d 200
> +binary-trees 13
> +chameneos 1e6
> +coroutine-ring 3e6
> +euler14-bit 5e6
> +fannkuch 10
> +fasta 2e6
> +k-nucleotide 5e5 FASTA_500000
> +life
> +mandelbrot 2000
> +mandelbrot-bit 2000
> +md5 5000
> +nbody 1e6
> +nsieve 9
> +nsieve-bit 9
> +nsieve-bit-fp 9
> +partialsums 2e6
> +pidigits-nogmp 2000
> +ray 4
> +recursive-ack 9
> +recursive-fib 37
> +revcomp 1e6 FASTA_1000000
> +scimark-fft 2000
> +scimark-lu 300
> +scimark-sor 5000
> +scimark-sparse 5e3
> +series 1500
> +spectral-norm 1000
> +sum-file 1000 SUMCOL_1000
> diff --git a/perf/LuaJIT-benches/PARAM_mips.txt b/perf/LuaJIT-benches/PARAM_mips.txt
> new file mode 100644
> index 00000000..e6bcadba
> --- /dev/null
> +++ b/perf/LuaJIT-benches/PARAM_mips.txt
> @@ -0,0 +1,29 @@
> +array3d 50
> +binary-trees 10
> +chameneos 5e4
> +coroutine-ring 2e5
> +euler14-bit 2e4
> +fannkuch 8
> +fasta 2e4
> +k-nucleotide 1e4 FASTA_10000
> +life
> +mandelbrot 150
> +mandelbrot-bit 150
> +md5 10
> +nbody 1e4
> +nsieve 4
> +nsieve-bit 4
> +nsieve-bit-fp 2
> +partialsums 5e4
> +pidigits-nogmp 150
> +ray 2
> +recursive-ack 7
> +recursive-fib 29
> +revcomp 5e4 FASTA_50000
> +scimark-fft 20
> +scimark-lu 3
> +scimark-sor 40
> +scimark-sparse 100
> +series 50
> +spectral-norm 100
> +sum-file 100 SUMCOL_100
> diff --git a/perf/LuaJIT-benches/PARAM_ppc.txt b/perf/LuaJIT-benches/PARAM_ppc.txt
> new file mode 100644
> index 00000000..c8319a15
> --- /dev/null
> +++ b/perf/LuaJIT-benches/PARAM_ppc.txt
> @@ -0,0 +1,29 @@
> +array3d 200
> +binary-trees 13
> +chameneos 1e6
> +coroutine-ring 4e6
> +euler14-bit 1e6
> +fannkuch 9
> +fasta 5e5
> +k-nucleotide 1e5 FASTA_100000
> +life
> +mandelbrot 800
> +mandelbrot-bit 800
> +md5 500
> +nbody 1e5
> +nsieve 8
> +nsieve-bit 8
> +nsieve-bit-fp 8
> +partialsums 5e5
> +pidigits-nogmp 800
> +ray 5
> +recursive-ack 9
> +recursive-fib 34
> +revcomp 1e6 FASTA_1000000
> +scimark-fft 500
> +scimark-lu 100
> +scimark-sor 1000
> +scimark-sparse 3000
> +series 1000
> +spectral-norm 200
> +sum-file 1000 SUMCOL_1000
> diff --git a/perf/LuaJIT-benches/PARAM_x86.txt b/perf/LuaJIT-benches/PARAM_x86.txt
> new file mode 100644
> index 00000000..87088d7b
> --- /dev/null
> +++ b/perf/LuaJIT-benches/PARAM_x86.txt
> @@ -0,0 +1,29 @@
> +array3d 300
> +binary-trees 16
> +chameneos 1e7
> +coroutine-ring 2e7
> +euler14-bit 2e7
> +fannkuch 11
> +fasta 25e6
> +k-nucleotide 5e6 FASTA_5000000
> +life
> +mandelbrot 5000
> +mandelbrot-bit 5000
> +md5 20000
> +nbody 5e6
> +nsieve 12
> +nsieve-bit 12
> +nsieve-bit-fp 12
> +partialsums 1e7
> +pidigits-nogmp 5000
> +ray 9
> +recursive-ack 10
> +recursive-fib 40
> +revcomp 5e6 FASTA_5000000
> +scimark-fft 50000
> +scimark-lu 5000
> +scimark-sor 50000
> +scimark-sparse 15e4
> +series 10000
> +spectral-norm 3000
> +sum-file 5000 SUMCOL_5000
> diff --git a/perf/LuaJIT-benches/SUMCOL_1.txt b/perf/LuaJIT-benches/SUMCOL_1.txt
> new file mode 100644
> index 00000000..956aba14
> --- /dev/null
> +++ b/perf/LuaJIT-benches/SUMCOL_1.txt
> @@ -0,0 +1,1000 @@
> +276
> +498
> +-981
> +770
> +-401
> +702
> +966
> +950
> +-853
> +-53
> +-293
> +604
> +288
> +892
> +-697
> +204
> +96
> +408
> +880
> +-7
> +-817
> +422
> +-261
> +-485
> +-77
> +826
> +184
> +864
> +-751
> +626
> +812
> +-369
> +-353
> +-371
> +488
> +-83
> +-659
> +24
> +524
> +-21
> +840
> +-757
> +-17
> +-973
> +-843
> +260
> +858
> +-389
> +-521
> +-99
> +482
> +-561
> +-213
> +630
> +766
> +932
> +112
> +-419
> +-877
> +762
> +266
> +-837
> +170
> +834
> +746
> +764
> +922
> +-89
> +576
> +-63
> +90
> +684
> +316
> +506
> +-959
> +708
> +70
> +252
> +-747
> +342
> +-593
> +-895
> +-937
> +-707
> +350
> +588
> +-201
> +-683
> +-113
> +-511
> +-867
> +322
> +202
> +472
> +150
> +-9
> +-643
> +28
> +336
> +86
> +-925
> +836
> +-473
> +-451
> +-971
> +-805
> +-619
> +84
> +-67
> +806
> +270
> +366
> +334
> +-555
> +-557
> +-331
> +-409
> +-553
> +-145
> +-71
> +528
> +490
> +492
> +828
> +628
> +-961
> +536
> +-859
> +-271
> +974
> +-671
> +-749
> +414
> +-257
> +778
> +56
> +598
> +-437
> +-899
> +-785
> +-987
> +32
> +-999
> +132
> +-821
> +-209
> +402
> +-543
> +194
> +-967
> +294
> +-943
> +-285
> +-483
> +-97
> +660
> +-481
> +-829
> +-309
> +-597
> +-855
> +80
> +-355
> +192
> +-823
> +436
> +916
> +282
> +-629
> +612
> +-329
> +-535
> +780
> +-47
> +706
> +110
> +756
> +-857
> +-933
> +-345
> +-523
> +718
> +-31
> +902
> +678
> +540
> +698
> +456
> +-399
> +126
> +412
> +-563
> +-321
> +-487
> +-641
> +-195
> +-199
> +-955
> +772
> +570
> +18
> +-217
> +886
> +984
> +-721
> +-995
> +46
> +-989
> +946
> +64
> +716
> +-719
> +-869
> +-579
> +776
> +450
> +936
> +980
> +-439
> +-977
> +-455
> +-997
> +6
> +268
> +-269
> +-421
> +328
> +352
> +578
> +-575
> +476
> +976
> +-57
> +-469
> +544
> +582
> +-43
> +510
> +-939
> +-581
> +-337
> +-203
> +-737
> +-827
> +852
> +-279
> +-803
> +-911
> +-865
> +548
> +48
> +-75
> +416
> +-275
> +688
> +-255
> +-687
> +-461
> +-233
> +420
> +912
> +-901
> +-299
> +12
> +568
> +694
> +-411
> +-883
> +-327
> +-361
> +-339
> +646
> +-137
> +-905
> +670
> +686
> +-131
> +-849
> +-825
> +256
> +228
> +-841
> +68
> +368
> +-909
> +242
> +298
> +118
> +10
> +222
> +954
> +-493
> +-459
> +-445
> +608
> +-765
> +34
> +468
> +-715
> +690
> +-185
> +-551
> +-571
> +-241
> +292
> +92
> +768
> +-923
> +956
> +614
> +8
> +730
> +208
> +-417
> +300
> +136
> +-59
> +-251
> +-539
> +166
> +798
> +866
> +454
> +-391
> +-317
> +668
> +502
> +-15
> +994
> +854
> +-189
> +666
> +446
> +-565
> +-5
> +42
> +-227
> +-87
> +-779
> +26
> +312
> +354
> +754
> +396
> +-515
> +220
> +872
> +654
> +88
> +-667
> +250
> +572
> +952
> +72
> +982
> +972
> +-529
> +-471
> +-533
> +-427
> +538
> +154
> +-457
> +-819
> +750
> +152
> +452
> +-41
> +838
> +-489
> +418
> +-649
> +-637
> +-197
> +74
> +394
> +-653
> +-727
> +-435
> +-23
> +348
> +638
> +-611
> +914
> +-357
> +-743
> +-685
> +580
> +-247
> +-577
> +54
> +-931
> +-3
> +558
> +-793
> +-443
> +-759
> +162
> +-811
> +384
> +720
> +-117
> +900
> +-519
> +-39
> +744
> +432
> +286
> +-873
> +380
> +-167
> +-283
> +430
> +-155
> +-755
> +206
> +100
> +364
> +-677
> +332
> +-567
> +382
> +-605
> +-181
> +676
> +-475
> +-845
> +910
> +546
> +14
> +398
> +616
> +-769
> +424
> +992
> +-235
> +-239
> +774
> +478
> +-919
> +168
> +-771
> +-773
> +-69
> +-509
> +930
> +550
> +-463
> +178
> +-861
> +-761
> +-795
> +234
> +-831
> +-61
> +-979
> +-851
> +-665
> +-709
> +896
> +742
> +-123
> +590
> +-693
> +-887
> +-379
> +144
> +-717
> +20
> +174
> +82
> +464
> +30
> +-969
> +-349
> +-531
> +-799
> +-661
> +-647
> +-623
> +878
> +148
> +-545
> +238
> +-259
> +554
> +726
> +-37
> +-797
> +98
> +78
> +-591
> +-975
> +962
> +120
> +906
> +-207
> +656
> +-171
> +652
> +188
> +672
> +-133
> +-91
> +224
> +818
> +-333
> +-839
> +-499
> +22
> +-739
> +142
> +378
> +-403
> +-315
> +370
> +284
> +122
> +230
> +-527
> +-127
> +442
> +534
> +160
> +722
> +262
> +-657
> +304
> +258
> +-103
> +960
> +-495
> +-265
> +634
> +-101
> +480
> +-363
> +308
> +76
> +-949
> +-585
> +904
> +146
> +-703
> +164
> +850
> +246
> +732
> +-725
> +566
> +274
> +-163
> +-935
> +-681
> +-229
> +254
> +-733
> +-547
> +-273
> +-903
> +736
> +-711
> +794
> +392
> +-655
> +-549
> +808
> +-429
> +484
> +-701
> +-617
> +804
> +36
> +-775
> +-335
> +-927
> +714
> +-177
> +-325
> +-413
> +-963
> +114
> +-253
> +-789
> +-645
> +40
> +434
> +898
> +924
> +-19
> +738
> +788
> +280
> +-121
> +594
> +-913
> +426
> +816
> +-373
> +-45
> +340
> +-109
> +-323
> +58
> +-249
> +940
> +-297
> +988
> +998
> +-607
> +-745
> +-633
> +-115
> +996
> +-893
> +696
> +400
> +848
> +500
> +-263
> +562
> +-807
> +-105
> +-603
> +658
> +-73
> +-863
> +448
> +680
> +-157
> +-161
> +728
> +814
> +-477
> +-375
> +1000
> +-631
> +-991
> +362
> +156
> +-187
> +-705
> +-917
> +-449
> +-741
> +556
> +440
> +-589
> +-11
> +-359
> +-891
> +-801
> +-153
> +-381
> +938
> +-173
> +-243
> +618
> +-599
> +-497
> +486
> +128
> +790
> +460
> +-27
> +-305
> +-205
> +-215
> +324
> +-341
> +50
> +458
> +52
> +-621
> +874
> +386
> +560
> +-569
> +-51
> +802
> +786
> +920
> +-425
> +466
> +444
> +-507
> +-915
> +346
> +622
> +-679
> +784
> +-689
> +388
> +508
> +-613
> +-313
> +-447
> +564
> +-897
> +-211
> +-225
> +-615
> +-367
> +186
> +894
> +-65
> +-453
> +-245
> +602
> +496
> +-651
> +-601
> +820
> +226
> +-695
> +-119
> +372
> +180
> +94
> +214
> +542
> +648
> +-871
> +592
> +584
> +824
> +796
> +374
> +-945
> +-311
> +516
> +942
> +-221
> +-433
> +200
> +-465
> +-953
> +870
> +868
> +-879
> +518
> +356
> +-223
> +682
> +990
> +-191
> +-541
> +-951
> +-921
> +-319
> +-169
> +-291
> +-289
> +792
> +876
> +306
> +-491
> +326
> +-885
> +62
> +514
> +-929
> +318
> +-231
> +632
> +44
> +-107
> +644
> +-267
> +-343
> +-847
> +934
> +734
> +-505
> +-351
> +574
> +-627
> +636
> +-93
> +-431
> +-835
> +428
> +-183
> +-151
> +2
> +-813
> +-595
> +958
> +-141
> +692
> +-385
> +610
> +-179
> +376
> +948
> +198
> +-675
> +964
> +-907
> +918
> +-165
> +-1
> +406
> +748
> +-111
> +532
> +-55
> +-281
> +740
> +504
> +236
> +-29
> +662
> +-713
> +-537
> +196
> +-587
> +822
> +-135
> +700
> +-35
> +674
> +-407
> +240
> +-673
> +-669
> +-393
> +470
> +-525
> +-875
> +-383
> +-625
> +296
> +-85
> +-147
> +-277
> +800
> +-691
> +-143
> +16
> +-983
> +-303
> +290
> +-139
> +172
> +320
> +512
> +596
> +640
> +664
> +-791
> +-783
> +-387
> +-735
> +-467
> +-301
> +810
> +134
> +216
> +278
> +176
> +606
> +140
> +-787
> +978
> +586
> +890
> +882
> +-753
> +-13
> +970
> +-941
> +-175
> +-777
> +-809
> +-441
> +-347
> +-377
> +390
> +-423
> +842
> +642
> +190
> +302
> +438
> +704
> +310
> +-49
> +124
> +-781
> +-287
> +724
> +-767
> +830
> +620
> +-295
> +244
> +-159
> +-307
> +-397
> +66
> +-237
> +314
> +-79
> +624
> +710
> +272
> +-365
> +928
> +856
> +138
> +-479
> +520
> +832
> +862
> +760
> +846
> +-81
> +106
> +-513
> +-193
> +650
> +782
> +-517
> +944
> +218
> +712
> +-663
> +-559
> +462
> +-635
> +-25
> +182
> +530
> +844
> +330
> +-833
> +102
> +-881
> +108
> +-947
> +-763
> +-405
> +232
> +410
> +104
> +-729
> +-149
> +-889
> +888
> +360
> +968
> +908
> +116
> +-815
> +-129
> +522
> +-723
> +-993
> +860
> +-503
> +926
> +-219
> +-415
> +60
> +158
> +-609
> +-501
> +986
> +-699
> +-583
> +884
> +212
> +210
> +-957
> +526
> +-985
> +552
> +344
> +-395
> +-95
> +338
> +248
> +494
> +130
> +404
> +358
> +600
> +-639
> +-125
> +-33
> +-965
> +752
> +474
> +-731
> +758
> +-573
> +4
> +38
> +264
> diff --git a/perf/LuaJIT-benches/TEST_md5sum.txt b/perf/LuaJIT-benches/TEST_md5sum.txt
> new file mode 100644
> index 00000000..15aa8a1c
> --- /dev/null
> +++ b/perf/LuaJIT-benches/TEST_md5sum.txt
> @@ -0,0 +1,20 @@
> +binarytrees 10 7202f4e13df7abc5ad8c07f05fe9d644
> +chameneos 1e5 a629ce12f63050c6656bce175258cf8f
> +cheapconcr 1000 d29799d1e263810a4db7bbf43ca66499
> +cheapconcw 1000 d29799d1e263810a4db7bbf43ca66499
> +fannkuch 8 51e5e372cbc5471ea8940b20ad782319
> +fasta 1e5 78cd327de6f0a5667da0aa9349888279
> +knucleotide x 88efb24c1fed533959ed84bb32c88142 <FASTA_10000
> +mandelbrot 200 cc65e64bd553ed18896de1dfe7fae3e5
> +meteor 3000 9a65bb4b0a735ace1eaa4f2628f01026
> +nbody 1e4 e0361c898ba747117ec177f7b3b3359c
> +nsieve 4 767e02c93624995732e151932fa5f304
> +nsievebits 4 767e02c93624995732e151932fa5f304
> +partialsums 1e5 33efb41c72f8ecfb5b36c99e32189a3f
> +pidigits 200 173a11a77bb1e72dd31254a760317428
> +recursive 4 07a47c2d2cf50503b16efda789f84916
> +regexdna x fdf3e6e9c599754e1eec3e524ea13fed <FASTA_10000
> +revcomp x 47de276e2f72519b57b82da39f4c7592 <FASTA_10000
> +spectralnorm 200 25f44bd552ccd9faa0ee2ae5617947e2
> +sumfile x 2ebd3caa45b31a2e74e436b645eab4b0 <SUMCOL_100
> +
> diff --git a/perf/LuaJIT-benches/array3d.lua b/perf/LuaJIT-benches/array3d.lua
> new file mode 100644
> index 00000000..c10b09b1
> --- /dev/null
> +++ b/perf/LuaJIT-benches/array3d.lua
> @@ -0,0 +1,59 @@
> +
> +local function array_set(self, x, y, z, p)
> + assert(x >= 0 and x < self.nx, "x outside PA")
> + assert(y >= 0 and y < self.ny, "y outside PA")
> + assert(z >= 0 and z < self.nz, "z outside PA")
> + local pos = (z*self.ny + y)*self.nx + x
> + local image = self.image
> + if self.packed then
> + local maxv = self.max_voltage
> + if p > maxv then self.max_voltage = p*2.0 end
> + local oldp = image[pos] or 0.0 -- Works with uninitialized table, too
> + if oldp > maxv then p = p + maxv*2.0 end
> + image[pos] = p
> + else
> + image[pos] = p
> + end
> + self.changed = true
> + self.changed_recently = true
> +end
> +
> +local function array_points(self)
> + local y, z = 0, 0
> + return function(self, x)
> + x = x + 1
> + if x >= self.nx then
> + x = 0
> + y = y + 1
> + if y >= self.ny then
> + y = 0
> + z = z + 1
> + if z >= self.nz then
> + return nil, nil, nil
> + end
> + end
> + end
> + return x, y, z
> + end, self, 0
> +end
> +
> +local function array_new(nx, ny, nz, packed)
> + return {
> + nx = nx, ny = ny, nz = nz,
> + packed = packed, max_voltage = 0.0,
> + changed = false, changed_recently = false,
> + image = {}, -- Preferably use a fixed-type, pre-sized array here.
> + set = array_set,
> + points = array_points,
> + }
> +end
> +
> +local dim = tonumber(arg and arg[1]) or 300 -- Array dimension dim^3
> +local packed = arg and arg[2] == "packed" -- Packed image or flat
> +local arr = array_new(dim, dim, dim, packed)
> +
> +for x,y,z inarr:points() do
> +arr:set(x, y, z, x*x)
> +end
> +assert(arr.image[dim^3-1] == (dim-1)^2)
> +
> diff --git a/perf/LuaJIT-benches/binary-trees.lua b/perf/LuaJIT-benches/binary-trees.lua
> new file mode 100644
> index 00000000..bf040466
> --- /dev/null
> +++ b/perf/LuaJIT-benches/binary-trees.lua
> @@ -0,0 +1,47 @@
> +
> +local function BottomUpTree(item, depth)
> + if depth > 0 then
> + local i = item + item
> + depth = depth - 1
> + local left, right = BottomUpTree(i-1, depth), BottomUpTree(i, depth)
> + return { item, left, right }
> + else
> + return { item }
> + end
> +end
> +
> +local function ItemCheck(tree)
> + if tree[2] then
> + return tree[1] + ItemCheck(tree[2]) - ItemCheck(tree[3])
> + else
> + return tree[1]
> + end
> +end
> +
> +local N = tonumber(arg and arg[1]) or 0
> +local mindepth = 4
> +local maxdepth = mindepth + 2
> +if maxdepth < N then maxdepth = N end
> +
> +do
> + local stretchdepth = maxdepth + 1
> + local stretchtree = BottomUpTree(0, stretchdepth)
> + io.write(string.format("stretch tree of depth %d\t check: %d\n",
> + stretchdepth, ItemCheck(stretchtree)))
> +end
> +
> +local longlivedtree = BottomUpTree(0, maxdepth)
> +
> +for depth=mindepth,maxdepth,2 do
> + local iterations = 2 ^ (maxdepth - depth + mindepth)
> + local check = 0
> + for i=1,iterations do
> + check = check + ItemCheck(BottomUpTree(1, depth)) +
> + ItemCheck(BottomUpTree(-1, depth))
> + end
> + io.write(string.format("%d\t trees of depth %d\t check: %d\n",
> + iterations*2, depth, check))
> +end
> +
> +io.write(string.format("long lived tree of depth %d\t check: %d\n",
> + maxdepth, ItemCheck(longlivedtree)))
> diff --git a/perf/LuaJIT-benches/chameneos.lua b/perf/LuaJIT-benches/chameneos.lua
> new file mode 100644
> index 00000000..78b64c3f
> --- /dev/null
> +++ b/perf/LuaJIT-benches/chameneos.lua
> @@ -0,0 +1,68 @@
> +
> +local co = coroutine
> +local create, resume, yield = co.create, co.resume, co.yield
> +
> +local N = tonumber(arg and arg[1]) or 10
> +local first, second
> +
> +-- Meet another creature.
> +local function meet(me)
> + while second do yield() end -- Wait until meeting place clears.
> + local other = first
> + if other then -- Hey, I found a new friend!
> + first = nil
> + second = me
> + else -- Sniff, nobody here (yet).
> + local n = N - 1
> + if n < 0 then return end -- Uh oh, the mall is closed.
> + N = n
> + first = me
> + repeat yield(); other = second until other -- Wait for another creature.
> + second = nil
> + yield() -- Be nice and let others meet up.
> + end
> + return other
> +end
> +
> +-- Create a very social creature.
> +local function creature(color)
> + return create(function()
> + local me = color
> + for met=0,1000000000 do
> + local other = meet(me)
> + if not other then return met end
> + if me ~= other then
> + if me == "blue" then me = other == "red" and "yellow" or "red"
> + elseif me == "red" then me = other == "blue" and "yellow" or "blue"
> + else me = other == "blue" and "red" or "blue" end
> + end
> + end
> + end)
> +end
> +
> +-- Trivial round-robin scheduler.
> +local function schedule(threads)
> + local resume = resume
> + local nthreads, meetings = #threads, 0
> + repeat
> + for i=1,nthreads do
> + local thr = threads[i]
> + if not thr then return meetings end
> + local ok, met = resume(thr)
> + if met then
> + meetings = meetings + met
> + threads[i] = nil
> + end
> + end
> + until false
> +end
> +
> +-- A bunch of colorful creatures.
> +local threads = {
> + creature("blue"),
> + creature("red"),
> + creature("yellow"),
> + creature("blue"),
> +}
> +
> +io.write(schedule(threads), "\n")
> diff --git a/perf/LuaJIT-benches/coroutine-ring.lua b/perf/LuaJIT-benches/coroutine-ring.lua
> new file mode 100644
> index 00000000..1e8c5ef6
> --- /dev/null
> +++ b/perf/LuaJIT-benches/coroutine-ring.lua
> @@ -0,0 +1,42 @@
> +-- The Computer Language Benchmarks Game
> +--http://shootout.alioth.debian.org/
> +-- contributed by Sam Roberts
> +-- reviewed by Bruno Massa
> +
> +local n = tonumber(arg and arg[1]) or 2e7
> +
> +-- fixed size pool
> +local poolsize = 503
> +local threads = {}
> +
> +-- cache these to avoid global environment lookups
> +local create = coroutine.create
> +local resume = coroutine.resume
> +local yield = coroutine.yield
> +
> +local id = 1
> +local token = 0
> +local ok
> +
> +local body = function(token)
> + while true do
> + token = yield(token + 1)
> + end
> +end
> +
> +-- create all threads
> +for id = 1, poolsize do
> + threads[id] = create(body)
> +end
> +
> +-- send the token
> +repeat
> + if id == poolsize then
> + id = 1
> + else
> + id = id + 1
> + end
> + ok, token = resume(threads[id], token)
> +until token == n
> +
> +io.write(id, "\n")
> diff --git a/perf/LuaJIT-benches/euler14-bit.lua b/perf/LuaJIT-benches/euler14-bit.lua
> new file mode 100644
> index 00000000..537f2bf3
> --- /dev/null
> +++ b/perf/LuaJIT-benches/euler14-bit.lua
> @@ -0,0 +1,22 @@
> +
> +local bit = require("bit")
> +local bnot, bor, band = bit.bnot, bit.bor, bit.band
> +local shl, shr = bit.lshift, bit.rshift
> +
> +local N = tonumber(arg and arg[1]) or 10000000
> +local cache, m, n = { 1 }, 1, 1
> +if arg and arg[2] then cache = nil end
> +for i=2,N do
> + local j = i
> + for len=1,1000000000 do
> + j = bor(band(shr(j,1), band(j,1)-1), band(shl(j,1)+j+1, bnot(band(j,1)-1)))
> + if cache then
> + local x = cache[j]; if x then j = x+len; break end
> + elseif j == 1 then
> + j = len+1; break
> + end
> + end
> + if cache then cache[i] = j end
> + if j > m then m, n = j, i end
> +end
> +io.write("Found ", n, " (chain length: ", m, ")\n")
> diff --git a/perf/LuaJIT-benches/fannkuch.lua b/perf/LuaJIT-benches/fannkuch.lua
> new file mode 100644
> index 00000000..2a4cd426
> --- /dev/null
> +++ b/perf/LuaJIT-benches/fannkuch.lua
> @@ -0,0 +1,50 @@
> +
> +local function fannkuch(n)
> + local p, q, s, odd, check, maxflips = {}, {}, {}, true, 0, 0
> + for i=1,n do p[i] = i; q[i] = i; s[i] = i end
> + repeat
> + -- Print max. 30 permutations.
> + if check < 30 then
> + if not p[n] then return maxflips end -- Catch n = 0, 1, 2.
> + io.write(unpack(p)); io.write("\n")
> + check = check + 1
> + end
> + -- Copy and flip.
> + local q1 = p[1] -- Cache 1st element.
> + if p[n] ~= n and q1 ~= 1 then -- Avoid useless work.
> + for i=2,n do q[i] = p[i] end -- Work on a copy.
> + local flips = 1 -- Flip ...
> + while true do
> + local qq = q[q1]
> + if qq == 1 then -- ... until 1st element is 1.
> + if flips > maxflips then maxflips = flips end -- New maximum?
> + break
> + end
> + q[q1] = q1
> + if q1 >= 4 then
> + local i, j = 2, q1 - 1
> + repeat q[i], q[j] = q[j], q[i]; i = i + 1; j = j - 1; until i >= j
> + end
> + q1 = qq
> + flips=flips+1
> + end
> + end
> + -- Permute.
> + if odd then
> + p[2], p[1] = p[1], p[2]; odd = false -- Rotate 1<-2.
> + else
> + p[2], p[3] = p[3], p[2]; odd = true -- Rotate 1<-2 and 1<-2<-3.
> + for i=3,n do
> + local sx = s[i]
> + if sx ~= 1 then s[i] = sx-1; break end
> + if i == n then return maxflips end -- Out of permutations.
> + s[i] = i
> + -- Rotate 1<-...<-i+1.
> + local t=p[1]; for j=i+1,1,-1 do p[j],t=t,p[j] end
> + end
> + end
> + until false
> +end
> +
> +local n = tonumber(arg and arg[1]) or 1
> +io.write("Pfannkuchen(", n, ") = ", fannkuch(n), "\n")
> diff --git a/perf/LuaJIT-benches/fasta.lua b/perf/LuaJIT-benches/fasta.lua
> new file mode 100644
> index 00000000..7ce60804
> --- /dev/null
> +++ b/perf/LuaJIT-benches/fasta.lua
> @@ -0,0 +1,95 @@
> +
> +local Last = 42
> +local function random(max)
> + local y = (Last * 3877 + 29573) % 139968
> + Last = y
> + return (max * y) / 139968
> +end
> +
> +local function make_repeat_fasta(id, desc, s, n)
> + local write, sub = io.write, string.sub
> + write(">", id, " ", desc, "\n")
> + local p, sn, s2 = 1, #s, s..s
> + for i=60,n,60 do
> + write(sub(s2, p, p + 59), "\n")
> + p = p + 60; if p > sn then p = p - sn end
> + end
> + local tail = n % 60
> + if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
> +end
> +
> +local function make_random_fasta(id, desc, bs, n)
> + io.write(">", id, " ", desc, "\n")
> + loadstring([=[
> + local write, char, unpack, n, random = io.write, string.char, unpack, ...
> + local buf, p = {}, 1
> + for i=60,n,60 do
> + for j=p,p+59 do ]=]..bs..[=[ end
> + buf[p+60] = 10; p = p + 61
> + if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
> + end
> + local tail = n % 60
> + if tail > 0 then
> + for j=p,p+tail-1 do ]=]..bs..[=[ end
> + p = p + tail; buf[p] = 10; p = p + 1
> + end
> + write(char(unpack(buf, 1, p-1)))
> + ]=], desc)(n, random)
> +end
> +
> +local function bisect(c, p, lo, hi)
> + local n = hi - lo
> + if n == 0 then return "buf[j] = "..c[hi].."\n" end
> + local mid = math.floor(n / 2)
> + return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
> + "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
> +end
> +
> +local function make_bisect(tab)
> + local c, p, sum = {}, {}, 0
> + for i,row in ipairs(tab) do
> + c[i] = string.byte(row[1])
> + sum = sum + row[2]
> + p[i] = sum
> + end
> + return "local r = random(1)\n"..bisect(c, p, 1, #tab)
> +end
> +
> +local alu =
> + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
> + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
> + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
> + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
> + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
> + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
> + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
> +
> +local iub = make_bisect{
> + { "a", 0.27 },
> + { "c", 0.12 },
> + { "g", 0.12 },
> + { "t", 0.27 },
> + { "B", 0.02 },
> + { "D", 0.02 },
> + { "H", 0.02 },
> + { "K", 0.02 },
> + { "M", 0.02 },
> + { "N", 0.02 },
> + { "R", 0.02 },
> + { "S", 0.02 },
> + { "V", 0.02 },
> + { "W", 0.02 },
> + { "Y", 0.02 },
> +}
> +
> +local homosapiens = make_bisect{
> + { "a", 0.3029549426680 },
> + { "c", 0.1979883004921 },
> + { "g", 0.1975473066391 },
> + { "t", 0.3015094502008 },
> +}
> +
> +local N = tonumber(arg and arg[1]) or 1000
> +make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
> +make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
> +make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
> diff --git a/perf/LuaJIT-benches/k-nucleotide.lua b/perf/LuaJIT-benches/k-nucleotide.lua
> new file mode 100644
> index 00000000..0bfb41be
> --- /dev/null
> +++ b/perf/LuaJIT-benches/k-nucleotide.lua
> @@ -0,0 +1,58 @@
> +
> +local function kfrequency(seq, freq, k, frame)
> + local sub = string.sub
> + local k1 = k - 1
> + for i=frame,#seq-k1,k do
> + local c = sub(seq, i, i+k1)
> + freq[c] = (freq[c] or 0) + 1
> + end
> +end
> +
> +local function count(seq, frag)
> + local k = #frag
> + local freq = {}
> + for frame=1,k do kfrequency(seq, freq, k, frame) end
> + io.write(freq[frag] or 0, "\t", frag, "\n")
> +end
> +
> +local function frequency(seq, k)
> + local freq = {}
> + for frame=1,k do kfrequency(seq, freq, k, frame) end
> + local sfreq, sn, sum = {}, 1, 0
> + for c,v in pairs(freq) do sfreq[sn] = c; sn = sn + 1; sum = sum + v end
> + table.sort(sfreq, function(a, b)
> + local fa, fb = freq[a], freq[b]
> + return fa == fb and a > b or fa > fb
> + end)
> + for _,c in ipairs(sfreq) do
> + io.write(string.format("%s %0.3f\n", c, (freq[c]*100)/sum))
> + end
> + io.write("\n")
> +end
> +
> +local function readseq()
> + local sub = string.sub
> + for line in io.lines() do
> + if sub(line, 1, 1) == ">" and sub(line, 2, 6) == "THREE" then break end
> + end
> + local lines, ln = {}, 0
> + for line in io.lines() do
> + local c = sub(line, 1, 1)
> + if c == ">" then
> + break
> + elseif c ~= ";" then
> + ln = ln + 1
> + lines[ln] = line
> + end
> + end
> + return string.upper(table.concat(lines, "", 1, ln))
> +end
> +
> +local seq = readseq()
> +frequency(seq, 1)
> +frequency(seq, 2)
> +count(seq, "GGT")
> +count(seq, "GGTA")
> +count(seq, "GGTATT")
> +count(seq, "GGTATTTTAATT")
> +count(seq, "GGTATTTTAATTTATAGT")
> diff --git a/perf/LuaJIT-benches/life.lua b/perf/LuaJIT-benches/life.lua
> new file mode 100644
> index 00000000..911d9fe1
> --- /dev/null
> +++ b/perf/LuaJIT-benches/life.lua
> @@ -0,0 +1,111 @@
> +-- life.lua
> +-- original by Dave Bollinger<DBollinger@compuserve.com> posted to lua-l
> +-- modified to use ANSI terminal escape sequences
> +-- modified to use for instead of while
> +
> +local write=io.write
> +
> +ALIVE="�" DEAD="�"
> +ALIVE="O" DEAD="-"
> +
> +function delay() -- NOTE: SYSTEM-DEPENDENT, adjust as necessary
> + for i=1,10000 do end
> + -- local i=os.clock()+1 while(os.clock()<i) do end
> +end
> +
> +function ARRAY2D(w,h)
> + local t = {w=w,h=h}
> + for y=1,h do
> + t[y] = {}
> + for x=1,w do
> + t[y][x]=0
> + end
> + end
> + return t
> +end
> +
> +_CELLS = {}
> +
> +-- give birth to a "shape" within the cell array
> +function _CELLS:spawn(shape,left,top)
> + for y=0,shape.h-1 do
> + for x=0,shape.w-1 do
> + self[top+y][left+x] = shape[y*shape.w+x+1]
> + end
> + end
> +end
> +
> +-- run the CA and produce the next generation
> +function _CELLS:evolve(next)
> + local ym1,y,yp1,yi=self.h-1,self.h,1,self.h
> + while yi > 0 do
> + local xm1,x,xp1,xi=self.w-1,self.w,1,self.w
> + while xi > 0 do
> + local sum = self[ym1][xm1] + self[ym1][x] + self[ym1][xp1] +
> + self[y][xm1] + self[y][xp1] +
> + self[yp1][xm1] + self[yp1][x] + self[yp1][xp1]
> + next[y][x] = ((sum==2) and self[y][x]) or ((sum==3) and 1) or 0
> + xm1,x,xp1,xi = x,xp1,xp1+1,xi-1
> + end
> + ym1,y,yp1,yi = y,yp1,yp1+1,yi-1
> + end
> +end
> +
> +-- output the array to screen
> +function _CELLS:draw()
> + local out="" -- accumulate to reduce flicker
> + for y=1,self.h do
> + for x=1,self.w do
> + out=out..(((self[y][x]>0) and ALIVE) or DEAD)
> + end
> + out=out.."\n"
> + end
> + write(out)
> +end
> +
> +-- constructor
> +function CELLS(w,h)
> + local c = ARRAY2D(w,h)
> + c.spawn = _CELLS.spawn
> + c.evolve = _CELLS.evolve
> + c.draw = _CELLS.draw
> + return c
> +end
> +
> +--
> +-- shapes suitable for use with spawn() above
> +--
> +HEART = { 1,0,1,1,0,1,1,1,1; w=3,h=3 }
> +GLIDER = { 0,0,1,1,0,1,0,1,1; w=3,h=3 }
> +EXPLODE = { 0,1,0,1,1,1,1,0,1,0,1,0; w=3,h=4 }
> +FISH = { 0,1,1,1,1,1,0,0,0,1,0,0,0,0,1,1,0,0,1,0; w=5,h=4 }
> +BUTTERFLY = { 1,0,0,0,1,0,1,1,1,0,1,0,0,0,1,1,0,1,0,1,1,0,0,0,1; w=5,h=5 }
> +
> +-- the main routine
> +function LIFE(w,h)
> + -- create two arrays
> + local thisgen = CELLS(w,h)
> + local nextgen = CELLS(w,h)
> +
> + -- create some life
> + -- about 1000 generations of fun, then a glider steady-state
> +thisgen:spawn(GLIDER,5,4)
> +thisgen:spawn(EXPLODE,25,10)
> +thisgen:spawn(FISH,4,12)
> +
> + -- run until break
> + local gen=1
> + write("\027[2J") -- ANSI clear screen
> + while 1 do
> +thisgen:evolve(nextgen)
> + thisgen,nextgen = nextgen,thisgen
> + write("\027[H") -- ANSI home cursor
> +thisgen:draw()
> + write("Life - generation ",gen,"\n")
> + gen=gen+1
> + if gen>2000 then break end
> + --delay() -- no delay
> + end
> +end
> +
> +LIFE(40,20)
> diff --git a/perf/LuaJIT-benches/mandelbrot-bit.lua b/perf/LuaJIT-benches/mandelbrot-bit.lua
> new file mode 100644
> index 00000000..91d96975
> --- /dev/null
> +++ b/perf/LuaJIT-benches/mandelbrot-bit.lua
> @@ -0,0 +1,33 @@
> +
> +local bit = require("bit")
> +local bor, band = bit.bor, bit.band
> +local shl, shr, rol = bit.lshift, bit.rshift, bit.rol
> +local write, char, unpack = io.write, string.char, unpack
> +local N = tonumber(arg and arg[1]) or 100
> +local M, buf = 2/N, {}
> +write("P4\n", N, " ", N, "\n")
> +for y=0,N-1 do
> + local Ci, b, p = y*M-1, -16777216, 0
> + local Ciq = Ci*Ci
> + for x=0,N-1,2 do
> + local Cr, Cr2 = x*M-1.5, (x+1)*M-1.5
> + local Zr, Zi, Zrq, Ziq = Cr, Ci, Cr*Cr, Ciq
> + local Zr2, Zi2, Zrq2, Ziq2 = Cr2, Ci, Cr2*Cr2, Ciq
> + b = rol(b, 2)
> + for i=1,49 do
> + Zi = Zr*Zi*2 + Ci; Zi2 = Zr2*Zi2*2 + Ci
> + Zr = Zrq-Ziq + Cr; Zr2 = Zrq2-Ziq2 + Cr2
> + Ziq = Zi*Zi; Ziq2 = Zi2*Zi2
> + Zrq = Zr*Zr; Zrq2 = Zr2*Zr2
> + if band(b, 2) ~= 0 and Zrq+Ziq > 4.0 then b = band(b, -3) end
> + if band(b, 1) ~= 0 and Zrq2+Ziq2 > 4.0 then b = band(b, -2) end
> + if band(b, 3) == 0 then break end
> + end
> + if b >= 0 then p = p + 1; buf[p] = b; b = -16777216; end
> + end
> + if b ~= -16777216 then
> + if band(N, 1) ~= 0 then b = shr(b, 1) end
> + p = p + 1; buf[p] = shl(b, 8-band(N, 7))
> + end
> + write(char(unpack(buf, 1, p)))
> +end
> diff --git a/perf/LuaJIT-benches/mandelbrot.lua b/perf/LuaJIT-benches/mandelbrot.lua
> new file mode 100644
> index 00000000..0ef595a2
> --- /dev/null
> +++ b/perf/LuaJIT-benches/mandelbrot.lua
> @@ -0,0 +1,23 @@
> +
> +local write, char, unpack = io.write, string.char, unpack
> +local N = tonumber(arg and arg[1]) or 100
> +local M, ba, bb, buf = 2/N, 2^(N%8+1)-1, 2^(8-N%8), {}
> +write("P4\n", N, " ", N, "\n")
> +for y=0,N-1 do
> + local Ci, b, p = y*M-1, 1, 0
> + for x=0,N-1 do
> + local Cr = x*M-1.5
> + local Zr, Zi, Zrq, Ziq = Cr, Ci, Cr*Cr, Ci*Ci
> + b = b + b
> + for i=1,49 do
> + Zi = Zr*Zi*2 + Ci
> + Zr = Zrq-Ziq + Cr
> + Ziq = Zi*Zi
> + Zrq = Zr*Zr
> + if Zrq+Ziq > 4.0 then b = b + 1; break; end
> + end
> + if b >= 256 then p = p + 1; buf[p] = 511 - b; b = 1; end
> + end
> + if b ~= 1 then p = p + 1; buf[p] = (ba-b)*bb; end
> + write(char(unpack(buf, 1, p)))
> +end
> diff --git a/perf/LuaJIT-benches/md5.lua b/perf/LuaJIT-benches/md5.lua
> new file mode 100644
> index 00000000..fdf6b4a7
> --- /dev/null
> +++ b/perf/LuaJIT-benches/md5.lua
> @@ -0,0 +1,183 @@
> +
> +local bit = require("bit")
> +local tobit, tohex, bnot = bit.tobit or bit.cast, bit.tohex, bit.bnot
> +local bor, band, bxor = bit.bor, bit.band, bit.bxor
> +local lshift, rshift, rol, bswap = bit.lshift, bit.rshift, bit.rol, bit.bswap
> +local byte, char, sub, rep = string.byte, string.char, string.sub, string.rep
> +
> +if not rol then -- Replacement function if rotates are missing.
> + local bor, shl, shr = bit.bor, bit.lshift, bit.rshift
> + function rol(a, b) return bor(shl(a, b), shr(a, 32-b)) end
> +end
> +
> +if not bswap then -- Replacement function if bswap is missing.
> + local bor, band, shl, shr = bit.bor, bit.band, bit.lshift, bit.rshift
> + function bswap(a)
> + return bor(shr(a, 24), band(shr(a, 8), 0xff00),
> + shl(band(a, 0xff00), 8), shl(a, 24));
> + end
> +end
> +
> +if not tohex then -- (Unreliable) replacement function if tohex is missing.
> + function tohex(a)
> + return string.sub(string.format("%08x", a), -8)
> + end
> +end
> +
> +local function tr_f(a, b, c, d, x, s)
> + return rol(bxor(d, band(b, bxor(c, d))) + a + x, s) + b
> +end
> +
> +local function tr_g(a, b, c, d, x, s)
> + return rol(bxor(c, band(d, bxor(b, c))) + a + x, s) + b
> +end
> +
> +local function tr_h(a, b, c, d, x, s)
> + return rol(bxor(b, c, d) + a + x, s) + b
> +end
> +
> +local function tr_i(a, b, c, d, x, s)
> + return rol(bxor(c, bor(b, bnot(d))) + a + x, s) + b
> +end
> +
> +local function transform(x, a1, b1, c1, d1)
> + local a, b, c, d = a1, b1, c1, d1
> +
> + a = tr_f(a, b, c, d, x[ 1] + 0xd76aa478, 7)
> + d = tr_f(d, a, b, c, x[ 2] + 0xe8c7b756, 12)
> + c = tr_f(c, d, a, b, x[ 3] + 0x242070db, 17)
> + b = tr_f(b, c, d, a, x[ 4] + 0xc1bdceee, 22)
> + a = tr_f(a, b, c, d, x[ 5] + 0xf57c0faf, 7)
> + d = tr_f(d, a, b, c, x[ 6] + 0x4787c62a, 12)
> + c = tr_f(c, d, a, b, x[ 7] + 0xa8304613, 17)
> + b = tr_f(b, c, d, a, x[ 8] + 0xfd469501, 22)
> + a = tr_f(a, b, c, d, x[ 9] + 0x698098d8, 7)
> + d = tr_f(d, a, b, c, x[10] + 0x8b44f7af, 12)
> + c = tr_f(c, d, a, b, x[11] + 0xffff5bb1, 17)
> + b = tr_f(b, c, d, a, x[12] + 0x895cd7be, 22)
> + a = tr_f(a, b, c, d, x[13] + 0x6b901122, 7)
> + d = tr_f(d, a, b, c, x[14] + 0xfd987193, 12)
> + c = tr_f(c, d, a, b, x[15] + 0xa679438e, 17)
> + b = tr_f(b, c, d, a, x[16] + 0x49b40821, 22)
> +
> + a = tr_g(a, b, c, d, x[ 2] + 0xf61e2562, 5)
> + d = tr_g(d, a, b, c, x[ 7] + 0xc040b340, 9)
> + c = tr_g(c, d, a, b, x[12] + 0x265e5a51, 14)
> + b = tr_g(b, c, d, a, x[ 1] + 0xe9b6c7aa, 20)
> + a = tr_g(a, b, c, d, x[ 6] + 0xd62f105d, 5)
> + d = tr_g(d, a, b, c, x[11] + 0x02441453, 9)
> + c = tr_g(c, d, a, b, x[16] + 0xd8a1e681, 14)
> + b = tr_g(b, c, d, a, x[ 5] + 0xe7d3fbc8, 20)
> + a = tr_g(a, b, c, d, x[10] + 0x21e1cde6, 5)
> + d = tr_g(d, a, b, c, x[15] + 0xc33707d6, 9)
> + c = tr_g(c, d, a, b, x[ 4] + 0xf4d50d87, 14)
> + b = tr_g(b, c, d, a, x[ 9] + 0x455a14ed, 20)
> + a = tr_g(a, b, c, d, x[14] + 0xa9e3e905, 5)
> + d = tr_g(d, a, b, c, x[ 3] + 0xfcefa3f8, 9)
> + c = tr_g(c, d, a, b, x[ 8] + 0x676f02d9, 14)
> + b = tr_g(b, c, d, a, x[13] + 0x8d2a4c8a, 20)
> +
> + a = tr_h(a, b, c, d, x[ 6] + 0xfffa3942, 4)
> + d = tr_h(d, a, b, c, x[ 9] + 0x8771f681, 11)
> + c = tr_h(c, d, a, b, x[12] + 0x6d9d6122, 16)
> + b = tr_h(b, c, d, a, x[15] + 0xfde5380c, 23)
> + a = tr_h(a, b, c, d, x[ 2] + 0xa4beea44, 4)
> + d = tr_h(d, a, b, c, x[ 5] + 0x4bdecfa9, 11)
> + c = tr_h(c, d, a, b, x[ 8] + 0xf6bb4b60, 16)
> + b = tr_h(b, c, d, a, x[11] + 0xbebfbc70, 23)
> + a = tr_h(a, b, c, d, x[14] + 0x289b7ec6, 4)
> + d = tr_h(d, a, b, c, x[ 1] + 0xeaa127fa, 11)
> + c = tr_h(c, d, a, b, x[ 4] + 0xd4ef3085, 16)
> + b = tr_h(b, c, d, a, x[ 7] + 0x04881d05, 23)
> + a = tr_h(a, b, c, d, x[10] + 0xd9d4d039, 4)
> + d = tr_h(d, a, b, c, x[13] + 0xe6db99e5, 11)
> + c = tr_h(c, d, a, b, x[16] + 0x1fa27cf8, 16)
> + b = tr_h(b, c, d, a, x[ 3] + 0xc4ac5665, 23)
> +
> + a = tr_i(a, b, c, d, x[ 1] + 0xf4292244, 6)
> + d = tr_i(d, a, b, c, x[ 8] + 0x432aff97, 10)
> + c = tr_i(c, d, a, b, x[15] + 0xab9423a7, 15)
> + b = tr_i(b, c, d, a, x[ 6] + 0xfc93a039, 21)
> + a = tr_i(a, b, c, d, x[13] + 0x655b59c3, 6)
> + d = tr_i(d, a, b, c, x[ 4] + 0x8f0ccc92, 10)
> + c = tr_i(c, d, a, b, x[11] + 0xffeff47d, 15)
> + b = tr_i(b, c, d, a, x[ 2] + 0x85845dd1, 21)
> + a = tr_i(a, b, c, d, x[ 9] + 0x6fa87e4f, 6)
> + d = tr_i(d, a, b, c, x[16] + 0xfe2ce6e0, 10)
> + c = tr_i(c, d, a, b, x[ 7] + 0xa3014314, 15)
> + b = tr_i(b, c, d, a, x[14] + 0x4e0811a1, 21)
> + a = tr_i(a, b, c, d, x[ 5] + 0xf7537e82, 6)
> + d = tr_i(d, a, b, c, x[12] + 0xbd3af235, 10)
> + c = tr_i(c, d, a, b, x[ 3] + 0x2ad7d2bb, 15)
> + b = tr_i(b, c, d, a, x[10] + 0xeb86d391, 21)
> +
> + return tobit(a+a1), tobit(b+b1), tobit(c+c1), tobit(d+d1)
> +end
> +
> +-- Note: this is copying the original string and NOT particularly fast.
> +-- A library for struct unpacking would make this task much easier.
> +local function md5(msg)
> + local len = #msg
> + msg = msg.."\128"..rep("\0", 63 - band(len + 8, 63))
> + ..char(band(lshift(len, 3), 255), band(rshift(len, 5), 255),
> + band(rshift(len, 13), 255), band(rshift(len, 21), 255))
> + .."\0\0\0\0"
> + local a, b, c, d = 0x67452301, 0xefcdab89, 0x98badcfe, 0x10325476
> + local x, k = {}, 1
> + for i=1,#msg,4 do
> + local m0, m1, m2, m3 = byte(msg, i, i+3)
> + x[k] = bor(m0, lshift(m1, 8), lshift(m2, 16), lshift(m3, 24))
> + if k == 16 then
> + a, b, c, d = transform(x, a, b, c, d)
> + k = 1
> + else
> + k = k + 1
> + end
> + end
> + return tohex(bswap(a))..tohex(bswap(b))..tohex(bswap(c))..tohex(bswap(d))
> +end
> +
> +assert(md5('') == 'd41d8cd98f00b204e9800998ecf8427e')
> +assert(md5('a') == '0cc175b9c0f1b6a831c399e269772661')
> +assert(md5('abc') == '900150983cd24fb0d6963f7d28e17f72')
> +assert(md5('message digest') == 'f96b697d7cb7938d525a2f31aaf161d0')
> +assert(md5('abcdefghijklmnopqrstuvwxyz') == 'c3fcd3d76192e4007dfb496cca67e13b')
> +assert(md5('ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789') ==
> + 'd174ab98d277d9f5a5611c2c9f419d9f')
> +assert(md5('12345678901234567890123456789012345678901234567890123456789012345678901234567890') ==
> + '57edf4a22be3c955ac49da2e2107b67a')
> +
> +local N = tonumber(arg and arg[1]) or 10000
> +
> + -- Credits: William Shakespeare, Romeo and Juliet
> +local txt = [[Rebellious subjects, enemies to peace,
> +Profaners of this neighbour-stained steel,--
> +Will they not hear? What, ho! you men, you beasts,
> +That quench the fire of your pernicious rage
> +With purple fountains issuing from your veins,
> +On pain of torture, from those bloody hands
> +Throw your mistemper'd weapons to the ground,
> +And hear the sentence of your moved prince.
> +Three civil brawls, bred of an airy word,
> +By thee, old Capulet, and Montague,
> +Have thrice disturb'd the quiet of our streets,
> +And made Verona's ancient citizens
> +Cast by their grave beseeming ornaments,
> +To wield old partisans, in hands as old,
> +Canker'd with peace, to part your canker'd hate:
> +If ever you disturb our streets again,
> +Your lives shall pay the forfeit of the peace.
> +For this time, all the rest depart away:
> +You Capulet; shall go along with me:
> +And, Montague, come you this afternoon,
> +To know our further pleasure in this case,
> +To old Free-town, our common judgment-place.
> +Once more, on pain of death, all men depart.]]
> + txt = txt..txt..txt..txt
> + txt = txt..txt..txt..txt
> +
> +for i=1,N do
> + res = md5(txt)
> +end
> +assert(res == 'a831e91e0f70eddcb70dc61c6f82f6cd')
> +
> diff --git a/perf/LuaJIT-benches/meteor.lua b/perf/LuaJIT-benches/meteor.lua
> new file mode 100644
> index 00000000..80588ab5
> --- /dev/null
> +++ b/perf/LuaJIT-benches/meteor.lua
> @@ -0,0 +1,220 @@
> +
> +-- Generate a decision tree based solver for the meteor puzzle.
> +local function generatesolver(countinit)
> + local pairs, ipairs, format = pairs, ipairs, string.format
> + local byte, min, sort = string.byte, math.min, table.sort
> +
> + -- Cached position to distance lookup.
> + local dist = setmetatable({}, { __index = function(t, xy)
> + local x = xy%10; local y = (xy-x)/10
> + if (x+y)%2 == 1 then y = y + 1; x = 10 - x end
> + local d = xy + 256*x*x + 1024*y*y; t[xy] = d; return d
> + end})
> +
> + -- Lookup table to validate a cell and to find its successor.
> + local ok = {}
> + for i=0,150 do ok[i] = false end
> + for i=99,0,-1 do
> + local x = i%10
> + if ((i-x)/10+x)%2 == 0 then
> + ok[i] = i + (ok[i+1] and 1 or (ok[i+2] and 2 or 3))
> + end
> + end
> +
> + -- Temporary board state for the island checks.
> + local islands, slide = {}, {20,22,24,26,28,31,33,35,37,39}
> + local bbc, bb = 0, {}
> + for i=0,19 do bb[i] = false; bb[i+80] = false end
> + for i=20,79 do bb[i] = ok[i] end
> +
> + -- Recursive flood fill algorithm.
> + local function fill(bb, p)
> + bbc = bbc + 1
> + local n = p+2; if bb[n] then bb[n] = false; fill(bb, n) end
> + n = p-2; if bb[n] then bb[n] = false; fill(bb, n) end
> + n = p-9; if bb[n] then bb[n] = false; fill(bb, n) end
> + n = p-11; if bb[n] then bb[n] = false; fill(bb, n) end
> + n = p+9; if bb[n] then bb[n] = false; fill(bb, n) end
> + n = p+11; if bb[n] then bb[n] = false; fill(bb, n) end
> + end
> +
> + -- Generate pruned, sliding decision trees.
> + local dtrees = {{}, {}, {}, {}, {}, {}, {}, {}, {}, {}}
> + local rot = { nil, {}, {}, {}, {}, {}, {}, {}, {}, {}, {}, {} }
> + for k=0,9 do
> + -- Generate 10 initial pieces from line noise. :-)
> + local t = { 60, 62, byte("@BMBIK@KT@GPIKR@IKIKT@GK@KM@BG", k*3+1, k*3+3) }
> + rot[1] = t
> + for i,xy in ipairs(t) do
> + local x = xy%10; local y = (xy-x-60)/10
> + -- Add 11 more variations by rotating and flipping.
> + for j=2,12 do
> + if j == 7 then y = -y else x,y = (x+3*y)/2, (y-x)/2 end
> + rot[j][i] = x+10*y
> + end
> + end
> + for r,v in ipairs(rot) do
> + -- Exploit symmetry and leave out half of the orientations of one piece.
> + -- The selected piece gives the best reduction of the solution space.
> + if k ~= 3 or r%2 == 0 then
> + -- Normalize to origin, add distance, sort by distance from origin.
> + local m = min(v[1], v[2], v[3], v[4], v[5])
> + for i=1,5 do v[i] = dist[v[i]-m] end
> + sort(v)
> + local v2, v3, v4, v5 = v[2]%256, v[3]%256, v[4]%256, v[5]%256
> + -- Slide the piece across 2 rows, prune the tree, check for islands.
> + for j,p in ipairs(slide) do
> + bb[p] = false
> + if ok[p+v2] and ok[p+v3] and ok[p+v4] and ok[p+v5] then -- Prune.
> + for i=p+1,79 do bb[i] = ok[i] end -- Clear remaining board.
> + bb[p+v2] = false; bb[p+v3] = false -- Add piece.
> + bb[p+v4] = false; bb[p+v5] = false
> + bbc = j -- Flood fill and count the filled positions.
> + if bb[71] then bb[71] = false; fill(bb, 71) end -- Lower left.
> + if bb[79] then bb[79] = false; fill(bb, 79) end -- Lower right.
> + local di = 0
> + if bbc < 22 then bbc = 26
> + elseif bbc < 26 then -- Island found, locate it, fill from above.
> + for i=p+2,79 do if bb[i] then di = i-p; break end end
> + for i=p-9,p-1 do if ok[i] then fill(bb, i) bbc = bbc - 1 end end
> + end
> + if bbc == 26 then -- Prune boards with static islands.
> + local tb = dtrees[j] -- Build decision tree in distance order.
> + local ta = tb[v2]; if not ta then ta = {}; tb[v2] = ta end
> + tb = ta[v3]; if not tb then tb = {}; ta[v3] = tb end
> + ta = tb[v4]; if not ta then ta = {}; tb[v4] = ta; islands[ta] = di
> + elseif islands[ta] ~= di then islands[ta] = 0 end
> + ta[v5] = di*10+k -- Leaves hold island check and piece number.
> + end
> + end
> + end
> + end
> + end
> + end
> +
> + local s = "local u0,u1,u2,u3,u4,u5,u6,u7,u8,u9" -- Piece use flags.
> + for p=0,99 do if ok[p] then s = s..",b"..p end end -- Board cells.
> + s = s.."\n"..[[
> +local countinit = ...
> +local count = countinit
> +local bmin, bmax, pcs = 9, 0, {}
> +local smin, smax
> +local write, reverse = io.write, string.reverse
> +
> +-- Print min/max boards.
> +local function printboard(s)
> + local flip = true
> + for x in string.gmatch(string.gsub(s, ".", "%1 "), "..........") do
> + write(x, flip and "\n " or "\n")
> + flip = not flip
> + end
> + write("\n")
> +end
> +
> +-- Print result.
> +local function printresult()
> + write(countinit-count, " solutions found\n\n")
> + printboard(smin)
> + printboard(smax)
> +end
> +
> +-- Generate piece lookup array from the order of use.
> +local function genp()
> + local p = pcs
> + p[u0] = "0" p[u1] = "1" p[u2] = "2" p[u3] = "3" p[u4] = "4"
> + p[u5] = "5" p[u6] = "6" p[u7] = "7" p[u8] = "8" p[u9] = "9"
> + return p
> +end
> +
> +-- Goal function.
> +local function f91(k)
> + if k ~= 10 then return end
> + count = count - 2 -- Need to count the symmetric solution, too.
> + repeat
> + -- Quick precheck before constructing the string.
> + local b0, b99 = b0, b99
> + if b0 <= bmin then bmin = b0 elseif b0 >= bmax then bmax = b0
> + elseif b99 <= bmin then bmin = b99 elseif b99 >= bmax then bmax = b99
> + else break end
> + -- Translate the filled board to a string.
> + local p = genp()
> + local s = p[b0] ]]
> + for p=2,99 do if ok[p] then s = s.."..p[b"..p.."]" end end
> + s = s..[[
> + -- Remember min/max boards, dito for the symmetric board.
> + if not smin then smin = s; smax = s
> + elseif s < smin then smin = s elseif s > smax then smax = s end
> + s = reverse(s)
> + if s < smin then smin = s elseif s > smax then smax = s end
> + until true
> + if count <= 0 then error() end -- Early abort if max count given.
> +end
> +local f93 = f91
> +]]
> +
> + -- Recursively convert the decision tree to Lua code.
> + local function codetree(tree, d, p, pn)
> + local found, s = false, ""
> + d = d + 1
> + for a,t in pairs(tree) do
> + local b = p+a
> + if b < 100 then -- Prune the tree at the lower border.
> + local pp = b ~= pn and pn or ok[b] -- Find maximum successor function.
> + if d >= 5 then -- Try to place the last cell of a piece and advance.
> + found = true
> + local u = t%10
> + local di = (t-u)/10
> + if di ~= 0 and d == 5 then
> + di = di + p; if pp == di then pp = ok[di] end
> + s = format("%sif b%d and not u%d and not b%d then b%d=k u%d=k f%d(k) u%d=N b%d=N end\n",
> + s, di, u, b, b, u, pp, u, b)
> + else
> + s = format("%sif not u%d and not b%d then b%d=k u%d=k f%d(k) u%d=N b%d=N end\n",
> + s, u, b, b, u, pp, u, b)
> + end
> + else -- Try to place an intermediate cell.
> + local di = d ~= 4 and 0 or islands[t]
> + if di == 0 then
> + local st = codetree(t, d, p, pp)
> + if st then
> + found = true
> + s = format("%sif not b%d then b%d=k\n%sb%d=N end\n", s, b, b, st, b)
> + end
> + else -- Combine island checks.
> + di = di + p; if pp == di then pp = ok[di] end
> + local st = codetree(t, 6, p, pp)
> + if st then
> + found = true
> + s = format("%sif b%d and not b%d then b%d=k\n%sb%d=N end\n", s, di, b, b, st, b)
> + end
> + end
> + end
> + end
> + end
> + return found and s
> + end
> +
> + -- Embed the decision tree into a function hierarchy.
> + local j = 5
> + for p=88,0,-1 do
> + local pn = ok[p]
> + if pn then
> + s = format("%slocal function f%d(k)\nlocal N if b%d then return f%d(k) end k=k+1 b%d=k\n%sb%d=N end\n",
> + s, p, p, pn, p, codetree(dtrees[j], 1, p, pn), p)
> + j = j - 1; if j == 0 then j = 10 end
> + end
> + end
> +
> + -- Compile and return solver function and result getter.
> + return loadstring(s.."return f0, printresult\n", "solver")(countinit)
> +end
> +
> +-- Generate the solver function hierarchy.
> +local solver, printresult = generatesolver(tonumber(arg and arg[1]) or 10000)
> +
> +-- The optimizer for LuaJIT 1.1.x is not helpful here, so turn it off.
> +if jit and jit.opt and jit.version_num < 10200 then jit.opt.start(0) end
> +
> +-- Run the solver protected to get partial results (max count or ctrl-c).
> +pcall(solver, 0)
> +printresult()
> diff --git a/perf/LuaJIT-benches/nbody.lua b/perf/LuaJIT-benches/nbody.lua
> new file mode 100644
> index 00000000..e0ff8f77
> --- /dev/null
> +++ b/perf/LuaJIT-benches/nbody.lua
> @@ -0,0 +1,119 @@
> +
> +local sqrt = math.sqrt
> +
> +local PI = 3.141592653589793
> +local SOLAR_MASS = 4 * PI * PI
> +local DAYS_PER_YEAR = 365.24
> +local bodies = {
> + { -- Sun
> + x = 0,
> + y = 0,
> + z = 0,
> + vx = 0,
> + vy = 0,
> + vz = 0,
> + mass = SOLAR_MASS
> + },
> + { -- Jupiter
> + x = 4.84143144246472090e+00,
> + y = -1.16032004402742839e+00,
> + z = -1.03622044471123109e-01,
> + vx = 1.66007664274403694e-03 * DAYS_PER_YEAR,
> + vy = 7.69901118419740425e-03 * DAYS_PER_YEAR,
> + vz = -6.90460016972063023e-05 * DAYS_PER_YEAR,
> + mass = 9.54791938424326609e-04 * SOLAR_MASS
> + },
> + { -- Saturn
> + x = 8.34336671824457987e+00,
> + y = 4.12479856412430479e+00,
> + z = -4.03523417114321381e-01,
> + vx = -2.76742510726862411e-03 * DAYS_PER_YEAR,
> + vy = 4.99852801234917238e-03 * DAYS_PER_YEAR,
> + vz = 2.30417297573763929e-05 * DAYS_PER_YEAR,
> + mass = 2.85885980666130812e-04 * SOLAR_MASS
> + },
> + { -- Uranus
> + x = 1.28943695621391310e+01,
> + y = -1.51111514016986312e+01,
> + z = -2.23307578892655734e-01,
> + vx = 2.96460137564761618e-03 * DAYS_PER_YEAR,
> + vy = 2.37847173959480950e-03 * DAYS_PER_YEAR,
> + vz = -2.96589568540237556e-05 * DAYS_PER_YEAR,
> + mass = 4.36624404335156298e-05 * SOLAR_MASS
> + },
> + { -- Neptune
> + x = 1.53796971148509165e+01,
> + y = -2.59193146099879641e+01,
> + z = 1.79258772950371181e-01,
> + vx = 2.68067772490389322e-03 * DAYS_PER_YEAR,
> + vy = 1.62824170038242295e-03 * DAYS_PER_YEAR,
> + vz = -9.51592254519715870e-05 * DAYS_PER_YEAR,
> + mass = 5.15138902046611451e-05 * SOLAR_MASS
> + }
> +}
> +
> +local function advance(bodies, nbody, dt)
> + for i=1,nbody do
> + local bi = bodies[i]
> + local bix, biy, biz, bimass = bi.x, bi.y, bi.z, bi.mass
> + local bivx, bivy, bivz = bi.vx, bi.vy, bi.vz
> + for j=i+1,nbody do
> + local bj = bodies[j]
> + local dx, dy, dz = bix-bj.x, biy-bj.y, biz-bj.z
> + local mag = sqrt(dx*dx + dy*dy + dz*dz)
> + mag = dt / (mag * mag * mag)
> + local bm = bj.mass*mag
> + bivx = bivx - (dx * bm)
> + bivy = bivy - (dy * bm)
> + bivz = bivz - (dz * bm)
> + bm = bimass*mag
> + bj.vx = bj.vx + (dx * bm)
> + bj.vy = bj.vy + (dy * bm)
> + bj.vz = bj.vz + (dz * bm)
> + end
> + bi.vx = bivx
> + bi.vy = bivy
> + bi.vz = bivz
> + bi.x = bix + dt * bivx
> + bi.y = biy + dt * bivy
> + bi.z = biz + dt * bivz
> + end
> +end
> +
> +local function energy(bodies, nbody)
> + local e = 0
> + for i=1,nbody do
> + local bi = bodies[i]
> + local vx, vy, vz, bim = bi.vx, bi.vy, bi.vz, bi.mass
> + e = e + (0.5 * bim * (vx*vx + vy*vy + vz*vz))
> + for j=i+1,nbody do
> + local bj = bodies[j]
> + local dx, dy, dz = bi.x-bj.x, bi.y-bj.y, bi.z-bj.z
> + local distance = sqrt(dx*dx + dy*dy + dz*dz)
> + e = e - ((bim * bj.mass) / distance)
> + end
> + end
> + return e
> +end
> +
> +local function offsetMomentum(b, nbody)
> + local px, py, pz = 0, 0, 0
> + for i=1,nbody do
> + local bi = b[i]
> + local bim = bi.mass
> + px = px + (bi.vx * bim)
> + py = py + (bi.vy * bim)
> + pz = pz + (bi.vz * bim)
> + end
> + b[1].vx = -px / SOLAR_MASS
> + b[1].vy = -py / SOLAR_MASS
> + b[1].vz = -pz / SOLAR_MASS
> +end
> +
> +local N = tonumber(arg and arg[1]) or 1000
> +local nbody = #bodies
> +
> +offsetMomentum(bodies, nbody)
> +io.write( string.format("%0.9f",energy(bodies, nbody)), "\n")
> +for i=1,N do advance(bodies, nbody, 0.01) end
> +io.write( string.format("%0.9f",energy(bodies, nbody)), "\n")
> diff --git a/perf/LuaJIT-benches/nsieve-bit-fp.lua b/perf/LuaJIT-benches/nsieve-bit-fp.lua
> new file mode 100644
> index 00000000..3971ec1f
> --- /dev/null
> +++ b/perf/LuaJIT-benches/nsieve-bit-fp.lua
> @@ -0,0 +1,37 @@
> +
> +local floor, ceil = math.floor, math.ceil
> +
> +local precision = 50 -- Maximum precision of lua_Number (minus safety margin).
> +local onebits = (2^precision)-1
> +
> +local function nsieve(p, m)
> + local cm = ceil(m/precision)
> + do local onebits = onebits; for i=0,cm do p[i] = onebits end end
> + local count, idx, bit = 0, 2, 2
> + for i=2,m do
> + local r = p[idx] / bit
> + if r - floor(r) >= 0.5 then -- Bit set?
> + local kidx, kbit = idx, bit
> + for k=i+i,m,i do
> + kidx = kidx + i
> + while kidx >= cm do kidx = kidx - cm; kbit = kbit + kbit end
> + local x = p[kidx]
> + local r = x / kbit
> + if r - floor(r) >= 0.5 then p[kidx] = x - kbit*0.5 end -- Clear bit.
> + end
> + count = count + 1
> + end
> + idx = idx + 1
> + if idx >= cm then idx = 0; bit = bit + bit end
> + end
> + return count
> +end
> +
> +local N = tonumber(arg and arg[1]) or 1
> +if N < 2 then N = 2 end
> +local primes = {}
> +
> +for i=0,2 do
> + local m = (2^(N-i))*10000
> + io.write(string.format("Primes up to %8d %8d\n", m, nsieve(primes, m)))
> +end
> diff --git a/perf/LuaJIT-benches/nsieve-bit.lua b/perf/LuaJIT-benches/nsieve-bit.lua
> new file mode 100644
> index 00000000..820a3726
> --- /dev/null
> +++ b/perf/LuaJIT-benches/nsieve-bit.lua
> @@ -0,0 +1,27 @@
> +
> +local bit = require("bit")
> +local band, bxor, rshift, rol = bit.band, bit.bxor, bit.rshift, bit.rol
> +
> +local function nsieve(p, m)
> + local count = 0
> + for i=0,rshift(m, 5) do p[i] = -1 end
> + for i=2,m do
> + if band(rshift(p[rshift(i, 5)], i), 1) ~= 0 then
> + count = count + 1
> + for j=i+i,m,i do
> + local jx = rshift(j, 5)
> + p[jx] = band(p[jx], rol(-2, j))
> + end
> + end
> + end
> + return count
> +end
> +
> +local N = tonumber(arg and arg[1]) or 1
> +if N < 2 then N = 2 end
> +local primes = {}
> +
> +for i=0,2 do
> + local m = (2^(N-i))*10000
> + io.write(string.format("Primes up to %8d %8d\n", m, nsieve(primes, m)))
> +end
> diff --git a/perf/LuaJIT-benches/nsieve.lua b/perf/LuaJIT-benches/nsieve.lua
> new file mode 100644
> index 00000000..6de0524f
> --- /dev/null
> +++ b/perf/LuaJIT-benches/nsieve.lua
> @@ -0,0 +1,21 @@
> +
> +local function nsieve(p, m)
> + for i=2,m do p[i] = true end
> + local count = 0
> + for i=2,m do
> + if p[i] then
> + for k=i+i,m,i do p[k] = false end
> + count = count + 1
> + end
> + end
> + return count
> +end
> +
> +local N = tonumber(arg and arg[1]) or 1
> +if N < 2 then N = 2 end
> +local primes = {}
> +
> +for i=0,2 do
> + local m = (2^(N-i))*10000
> + io.write(string.format("Primes up to %8d %8d\n", m, nsieve(primes, m)))
> +end
> diff --git a/perf/LuaJIT-benches/partialsums.lua b/perf/LuaJIT-benches/partialsums.lua
> new file mode 100644
> index 00000000..46bb9da3
> --- /dev/null
> +++ b/perf/LuaJIT-benches/partialsums.lua
> @@ -0,0 +1,29 @@
> +
> +local n = tonumber(arg[1])
> +local function pr(fmt, x) io.write(string.format(fmt, x)) end
> +
> +local a1, a2, a3, a4, a5, a6, a7, a8, a9, alt = 1, 0, 0, 0, 0, 0, 0, 0, 0, 1
> +local sqrt, sin, cos = math.sqrt, math.sin, math.cos
> +for k=1,n do
> + local k2, sk, ck = k*k, sin(k), cos(k)
> + local k3 = k2*k
> + a1 = a1 + (2/3)^k
> + a2 = a2 + 1/sqrt(k)
> + a3 = a3 + 1/(k2+k)
> + a4 = a4 + 1/(k3*sk*sk)
> + a5 = a5 + 1/(k3*ck*ck)
> + a6 = a6 + 1/k
> + a7 = a7 + 1/k2
> + a8 = a8 + alt/k
> + a9 = a9 + alt/(k+k-1)
> + alt = -alt
> +end
> +pr("%.9f\t(2/3)^k\n", a1)
> +pr("%.9f\tk^-0.5\n", a2)
> +pr("%.9f\t1/k(k+1)\n", a3)
> +pr("%.9f\tFlint Hills\n", a4)
> +pr("%.9f\tCookson Hills\n", a5)
> +pr("%.9f\tHarmonic\n", a6)
> +pr("%.9f\tRiemann Zeta\n", a7)
> +pr("%.9f\tAlternating Harmonic\n", a8)
> +pr("%.9f\tGregory\n", a9)
> diff --git a/perf/LuaJIT-benches/pidigits-nogmp.lua b/perf/LuaJIT-benches/pidigits-nogmp.lua
> new file mode 100644
> index 00000000..63a1cb0e
> --- /dev/null
> +++ b/perf/LuaJIT-benches/pidigits-nogmp.lua
> @@ -0,0 +1,100 @@
> +
> +-- Start of dynamically compiled chunk.
> +local chunk = [=[
> +
> +-- Factory function for multi-precision number (mpn) operations.
> +local function fmm(fa, fb)
> + return loadstring([[
> + return function(y, a, ka, b, kb)
> + local carry, n = 0, #a ]]..(fb == 0 and "" or [[
> + local na, nb = n, #b -- Need to adjust lengths. 1 element suffices here.
> + if na > nb then b[na] = 0 elseif na < nb then a[nb] = 0; n = nb end
> + ]])..[[
> + for i=1,n do -- Sum up all elements and propagate carry.
> + local x = a[i] ]]..(fa == 2 and "*ka" or "")..
> + (fb == 2 and "+b[i]*kb" or (fb == 1 and "+b[i]" or ""))..[[ + carry
> + if x < RADIX and x >= 0 then carry = 0; y[i] = x -- Check for overflow.
> + else local d = x % RADIX; carry = (x-d) / RADIX; y[i] = d end
> + end
> + y[n+1] = nil -- Truncate target. 1 element suffices here.
> + if carry == 0 then while n > 0 and y[n] == 0 do y[n] = nil end
> + elseif carry == -1 then y[n] = y[n] - RADIX else y[n+1] = carry end
> + ]]..(fb == 0 and "" or [[ -- Undo length adjustment.
> + if na > nb then b[na] = nil elseif na < nb and y ~= a then a[nb] = nil end
> + ]])..[[
> + return y
> + end]])()
> +end
> +
> +-- Generate needed mpn functions.
> +local mm_kk, mm_k1, mm_k0, mm_11 = fmm(2, 2), fmm(2, 1), fmm(2, 0), fmm(1, 1)
> +
> +-- Choose the most efficient mpn function for y = a*ka + b*kb at run-time.
> +local function mm(y, a, ka, b, kb)
> + local f = mm_kk
> + if kb == 0 or #b == 0 then if ka == 1 then return a else f = mm_k0 end
> + elseif kb == 1 then if ka == 1 then f = mm_11 else f = mm_k1 end end
> + return f(y, a, ka, b, kb)
> +end
> +
> +-- Compose matrix with numbers on the right.
> +local function compose_r(aq,ar,as,at, bq,br,bs,bt)
> + mm(ar, ar,bq, at,br) mm(at, at,bt, ar,bs)
> + mm(as, as,bt, aq,bs) mm(aq, aq,bq, nil,0)
> +end
> +
> +-- Compose matrix with numbers on the left.
> +local function compose_l(aq,ar,as,at, bq,br,bs,bt)
> + mm(ar, ar,bt, aq,br) mm(at, at,bt, as,br)
> + mm(as, as,bq, at,bs) mm(aq, aq,bq, nil,0)
> +end
> +
> +-- Extract one digit.
> +local u, v, jj = {}, {}, 0
> +local function extract(q,r,s,t, j)
> + local u = j == jj + 1 and mm(u, u,1, q,1) or mm(u, q,j, r,1); jj = j
> + local v = mm(v, t,1, s,j)
> + local nu, nv, y = #u, #v
> + if nu == nv then
> + if nu == 1 then y = u[1] / v[1]
> + else y = (u[nu]*RADIX + u[nu-1]) / (v[nv]*RADIX + v[nv-1]) end
> + elseif nu == nv+1 then y = (u[nu]*RADIX + u[nv]) / v[nv]
> + else return 0 end
> + return math.floor(y)
> +end
> +
> +-- Coroutine which yields successive digits of PI.
> +return coroutine.wrap(function()
> + local q, r, s, t, k = {1}, {}, {}, {1}, 1
> + repeat
> + local y = extract(q,r,s,t, 3)
> + if y == extract(q,r,s,t, 4) then
> + coroutine.yield(y)
> + compose_r(q,r,s,t, 10, -10*y, 0, 1)
> + else
> + compose_l(q,r,s,t, k, 4*k+2, 0, 2*k+1)
> + k = k + 1
> + end
> + until false
> +end)
> +
> +]=] -- End of dynamically compiled chunk.
> +
> +local N = tonumber(arg and arg[1]) or 27
> +local RADIX = N < 6500 and 2^36 or 2^32 -- Avoid overflow.
> +
> +-- Substitute radix and compile chunk.
> +local pidigit = loadstring(string.gsub(chunk, "RADIX", tostring(RADIX)))()
> +
> +-- Print lines with 10 digits.
> +for i=10,N,10 do
> + for j=1,10 do io.write(pidigit()) end
> + io.write("\t:", i, "\n")
> +end
> +
> +-- Print remaining digits (if any).
> +local n10 = N % 10
> +if n10 ~= 0 then
> + for i=1,n10 do io.write(pidigit()) end
> + io.write(string.rep(" ", 10-n10), "\t:", N, "\n")
> +end
> diff --git a/perf/LuaJIT-benches/ray.lua b/perf/LuaJIT-benches/ray.lua
> new file mode 100644
> index 00000000..2acc24c0
> --- /dev/null
> +++ b/perf/LuaJIT-benches/ray.lua
> @@ -0,0 +1,135 @@
> +local sqrt = math.sqrt
> +local huge = math.huge
> +
> +local delta = 1
> +while delta * delta + 1 ~= 1 do
> + delta = delta * 0.5
> +end
> +
> +local function length(x, y, z) return sqrt(x*x + y*y + z*z) end
> +local function vlen(v) return length(v[1], v[2], v[3]) end
> +local function mul(c, x, y, z) return c*x, c*y, c*z end
> +local function unitise(x, y, z) return mul(1/length(x, y, z), x, y, z) end
> +local function dot(x1, y1, z1, x2, y2, z2)
> + return x1*x2 + y1*y2 + z1*z2
> +end
> +
> +local function vsub(a, b) return a[1] - b[1], a[2] - b[2], a[3] - b[3] end
> +local function vdot(a, b) return dot(a[1], a[2], a[3], b[1], b[2], b[3]) end
> +
> +
> +local sphere = {}
> +functionsphere:new(centre, radius)
> + self.__index = self
> + return setmetatable({centre=centre, radius=radius}, self)
> +end
> +
> +local function sphere_distance(self, origin, dir)
> + local vx, vy, vz = vsub(self.centre, origin)
> + local b = dot(vx, vy, vz, dir[1], dir[2], dir[3])
> + local r = self.radius
> + local disc = r*r + b*b - vx*vx-vy*vy-vz*vz
> + if disc < 0 then return huge end
> + local d = sqrt(disc)
> + local t2 = b + d
> + if t2 < 0 then return huge end
> + local t1 = b - d
> + return t1 > 0 and t1 or t2
> +end
> +
> +functionsphere:intersect(origin, dir, best)
> + local lambda = sphere_distance(self, origin, dir)
> + if lambda < best[1] then
> + local c = self.centre
> + best[1] = lambda
> + local b2 = best[2]
> + b2[1], b2[2], b2[3] =
> + unitise(
> + origin[1] - c[1] + lambda * dir[1],
> + origin[2] - c[2] + lambda * dir[2],
> + origin[3] - c[3] + lambda * dir[3])
> + end
> +end
> +
> +local group = {}
> +functiongroup:new(bound)
> + self.__index = self
> + return setmetatable({bound=bound, children={}}, self)
> +end
> +
> +functiongroup:add(s)
> + self.children[#self.children+1] = s
> +end
> +
> +functiongroup:intersect(origin, dir, best)
> + local lambda = sphere_distance(self.bound, origin, dir)
> + if lambda < best[1] then
> + for _, c in ipairs(self.children) do
> +c:intersect(origin, dir, best)
> + end
> + end
> +end
> +
> +local hit = { 0, 0, 0 }
> +local ilight
> +local best = { huge, { 0, 0, 0 } }
> +
> +local function ray_trace(light, camera, dir, scene)
> + best[1] = huge
> +scene:intersect(camera, dir, best)
> + local b1 = best[1]
> + if b1 == huge then return 0 end
> + local b2 = best[2]
> + local g = vdot(b2, light)
> + if g >= 0 then return 0 end
> + hit[1] = camera[1] + b1*dir[1] + delta*b2[1]
> + hit[2] = camera[2] + b1*dir[2] + delta*b2[2]
> + hit[3] = camera[3] + b1*dir[3] + delta*b2[3]
> + best[1] = huge
> +scene:intersect(hit, ilight, best)
> + if best[1] == huge then
> + return -g
> + else
> + return 0
> + end
> +end
> +
> +local function create(level, centre, radius)
> + local s =sphere:new(centre, radius)
> + if level == 1 then return s end
> + local gr =group:new(sphere:new(centre, 3*radius))
> +gr:add(s)
> + local rn = 3*radius/sqrt(12)
> + for dz = -1,1,2 do
> + for dx = -1,1,2 do
> +gr:add(create(level-1, { centre[1] + rn*dx, centre[2] + rn, centre[3] + rn*dz }, radius*0.5))
> + end
> + end
> + return gr
> +end
> +
> +
> +local level, n, ss = tonumber(arg[1]) or 9, tonumber(arg[2]) or 256, 4
> +local iss = 1/ss
> +local gf = 255/(ss*ss)
> +
> +io.write(("P5\n%d %d\n255\n"):format(n, n))
> +local light = { unitise(-1, -3, 2) }
> +ilight = { -light[1], -light[2], -light[3] }
> +local camera = { 0, 0, -4 }
> +local dir = { 0, 0, 0 }
> +
> +local scene = create(level, {0, -1, 0}, 1)
> +
> +for y = n/2-1, -n/2, -1 do
> + for x = -n/2, n/2-1 do
> + local g = 0
> + for d = y, y+.99, iss do
> + for e = x, x+.99, iss do
> + dir[1], dir[2], dir[3] = unitise(e, d, n)
> + g = g + ray_trace(light, camera, dir, scene)
> + end
> + end
> + io.write(string.char(math.floor(0.5 + g*gf)))
> + end
> +end
> diff --git a/perf/LuaJIT-benches/recursive-ack.lua b/perf/LuaJIT-benches/recursive-ack.lua
> new file mode 100644
> index 00000000..fad30589
> --- /dev/null
> +++ b/perf/LuaJIT-benches/recursive-ack.lua
> @@ -0,0 +1,8 @@
> +local function Ack(m, n)
> + if m == 0 then return n+1 end
> + if n == 0 then return Ack(m-1, 1) end
> + return Ack(m-1, (Ack(m, n-1))) -- The parentheses are deliberate.
> +end
> +
> +local N = tonumber(arg and arg[1]) or 10
> +io.write("Ack(3,", N ,"): ", Ack(3,N), "\n")
> diff --git a/perf/LuaJIT-benches/recursive-fib.lua b/perf/LuaJIT-benches/recursive-fib.lua
> new file mode 100644
> index 00000000..ef9950de
> --- /dev/null
> +++ b/perf/LuaJIT-benches/recursive-fib.lua
> @@ -0,0 +1,7 @@
> +local function fib(n)
> + if n < 2 then return 1 end
> + return fib(n-2) + fib(n-1)
> +end
> +
> +local n = tonumber(arg[1]) or 10
> +io.write(string.format("Fib(%d): %d\n", n, fib(n)))
> diff --git a/perf/LuaJIT-benches/revcomp.lua b/perf/LuaJIT-benches/revcomp.lua
> new file mode 100644
> index 00000000..34fe347b
> --- /dev/null
> +++ b/perf/LuaJIT-benches/revcomp.lua
> @@ -0,0 +1,37 @@
> +
> +local sub = string.sub
> +iubc = setmetatable({
> + A="T", C="G", B="V", D="H", K="M", R="Y",
> + a="T", c="G", b="V", d="H", k="M", r="Y",
> + T="A", G="C", V="B", H="D", M="K", Y="R", U="A",
> + t="A", g="C", v="B", h="D", m="K", y="R", u="A",
> + N="N", S="S", W="W", n="N", s="S", w="W",
> +}, { __index = function(t, s)
> + local r = t[sub(s, 2)]..t[sub(s, 1, 1)]; t[s] = r; return r end })
> +
> +local wcode = [=[
> +return function(t, n)
> + if n == 1 then return end
> + local iubc, sub, write = iubc, string.sub, io.write
> + local s = table.concat(t, "", 1, n-1)
> + for i=#s-59,1,-60 do
> + write(]=]
> +for i=59,3,-4 do wcode = wcode.."iubc[sub(s, i+"..(i-3)..", i+"..i..")], " end
> +wcode = wcode..[=["\n")
> + end
> + local r = #s % 60
> + if r ~= 0 then
> + for i=r,1,-4 do write(iubc[sub(s, i-3 < 1 and 1 or i-3, i)]) end
> + write("\n")
> + end
> +end
> +]=]
> +local writerev = loadstring(wcode)()
> +
> +local t, n = {}, 1
> +for line in io.lines() do
> + local c = sub(line, 1, 1)
> + if c == ">" then writerev(t, n); io.write(line, "\n"); n = 1
> + elseif c ~= ";" then t[n] = line; n = n + 1 end
> +end
> +writerev(t, n)
> diff --git a/perf/LuaJIT-benches/scimark-2010-12-20.lua b/perf/LuaJIT-benches/scimark-2010-12-20.lua
> new file mode 100644
> index 00000000..353acb7c
> --- /dev/null
> +++ b/perf/LuaJIT-benches/scimark-2010-12-20.lua
> @@ -0,0 +1,400 @@
> +------------------------------------------------------------------------------
> +-- Lua SciMark (2010-12-20).
> +--
> +-- A literal translation of SciMark 2.0a, written in Java and C.
> +-- Credits go to the original authors Roldan Pozo and Bruce Miller.
> +-- See:http://math.nist.gov/scimark2/
> +------------------------------------------------------------------------------
> +
> +local SCIMARK_VERSION = "2010-12-10"
> +local SCIMARK_COPYRIGHT = "Copyright (C) 2006-2010 Mike Pall"
> +
> +local MIN_TIME = 2.0
> +local RANDOM_SEED = 101009 -- Must be odd.
> +local SIZE_SELECT = "small"
> +
> +local benchmarks = {
> + "FFT", "SOR", "MC", "SPARSE", "LU",
> + small = {
> + FFT = { 1024 },
> + SOR = { 100 },
> + MC = { },
> + SPARSE = { 1000, 5000 },
> + LU = { 100 },
> + },
> + large = {
> + FFT = { 1048576 },
> + SOR = { 1000 },
> + MC = { },
> + SPARSE = { 100000, 1000000 },
> + LU = { 1000 },
> + },
> +}
> +
> +local abs, log, sin, floor = math.abs, math.log, math.sin, math.floor
> +local pi, clock = math.pi, os.clock
> +local format = string.format
> +
> +------------------------------------------------------------------------------
> +-- Select array type: Lua tables or native (FFI) arrays
> +------------------------------------------------------------------------------
> +
> +local darray, iarray
> +
> +local function array_init()
> + if jit and jit.status and jit.status() then
> + local ok, ffi = pcall(require, "ffi")
> + if ok then
> + darray = ffi.typeof("double[?]")
> + iarray = ffi.typeof("int[?]")
> + return
> + end
> + end
> + function darray(n) return {} end
> + iarray = darray
> +end
> +
> +------------------------------------------------------------------------------
> +-- This is a Lagged Fibonacci Pseudo-random Number Generator with
> +-- j, k, M = 5, 17, 31. Pretty weak, but same as C/Java SciMark.
> +------------------------------------------------------------------------------
> +
> +local rand, rand_init
> +
> +if jit and jit.status and jit.status() then
> + -- LJ2 has bit operations and zero-based arrays (internally).
> + local bit = require("bit")
> + local band, sar = bit.band, bit.arshift
> + function rand_init(seed)
> + local Rm, Rj, Ri = iarray(17), 16, 11
> + for i=0,16 do Rm[i] = 0 end
> + for i=16,0,-1 do
> + seed = band(seed*9069, 0x7fffffff)
> + Rm[i] = seed
> + end
> + function rand()
> + local i = band(Ri+1, sar(Ri-16, 31))
> + local j = band(Rj+1, sar(Rj-16, 31))
> + Ri, Rj = i, j
> + local k = band(Rm[i] - Rm[j], 0x7fffffff)
> + Rm[j] = k
> + return k * (1.0/2147483647.0)
> + end
> + end
> +else
> + -- Better for standard Lua with one-based arrays and without bit operations.
> + function rand_init(seed)
> + local Rm, Rj = {}, 1
> + for i=1,17 do Rm[i] = 0 end
> + for i=17,1,-1 do
> + seed = (seed*9069) % (2^31)
> + Rm[i] = seed
> + end
> + function rand()
> + local j, m = Rj, Rm
> + local h = j - 5
> + if h < 1 then h = h + 17 end
> + local k = m[h] - m[j]
> + if k < 0 then k = k + 2147483647 end
> + m[j] = k
> + if j < 17 then Rj = j + 1 else Rj = 1 end
> + return k * (1.0/2147483647.0)
> + end
> + end
> +end
> +
> +local function random_vector(n)
> + local v = darray(n+1)
> + for x=1,n do v[x] = rand() end
> + return v
> +end
> +
> +local function random_matrix(m, n)
> + local a = {}
> + for y=1,m do
> + local v = darray(n+1)
> + a[y] = v
> + for x=1,n do v[x] = rand() end
> + end
> + return a
> +end
> +
> +------------------------------------------------------------------------------
> +-- FFT: Fast Fourier Transform.
> +------------------------------------------------------------------------------
> +
> +local function fft_bitreverse(v, n)
> + local j = 0
> + for i=0,2*n-4,2 do
> + if i < j then
> + v[i+1], v[i+2], v[j+1], v[j+2] = v[j+1], v[j+2], v[i+1], v[i+2]
> + end
> + local k = n
> + while k <= j do j = j - k; k = k / 2 end
> + j = j + k
> + end
> +end
> +
> +local function fft_transform(v, n, dir)
> + if n <= 1 then return end
> + fft_bitreverse(v, n)
> + local dual = 1
> + repeat
> + local dual2 = 2*dual
> + for i=1,2*n-1,2*dual2 do
> + local j = i+dual2
> + local ir, ii = v[i], v[i+1]
> + local jr, ji = v[j], v[j+1]
> + v[j], v[j+1] = ir - jr, ii - ji
> + v[i], v[i+1] = ir + jr, ii + ji
> + end
> + local theta = dir * pi / dual
> + local s, s2 = sin(theta), 2.0 * sin(theta * 0.5)^2
> + local wr, wi = 1.0, 0.0
> + for a=3,dual2-1,2 do
> + wr, wi = wr - s*wi - s2*wr, wi + s*wr - s2*wi
> + for i=a,a+2*(n-dual2),2*dual2 do
> + local j = i+dual2
> + local jr, ji = v[j], v[j+1]
> + local dr, di = wr*jr - wi*ji, wr*ji + wi*jr
> + local ir, ii = v[i], v[i+1]
> + v[j], v[j+1] = ir - dr, ii - di
> + v[i], v[i+1] = ir + dr, ii + di
> + end
> + end
> + dual = dual2
> + until dual >= n
> +end
> +
> +function benchmarks.FFT(n)
> + local l2n = log(n)/log(2)
> + if l2n % 1 ~= 0 then
> +io.stderr:write("Error: FFT data length is not a power of 2\n")
> + os.exit(1)
> + end
> + local v = random_vector(n*2)
> + return function(cycles)
> + local norm = 1.0 / n
> + for p=1,cycles do
> + fft_transform(v, n, -1)
> + fft_transform(v, n, 1)
> + for i=1,n*2 do v[i] = v[i] * norm end
> + end
> + return ((5*n-2)*l2n + 2*(n+1)) * cycles
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- SOR: Jacobi Successive Over-Relaxation.
> +------------------------------------------------------------------------------
> +
> +local function sor_run(mat, m, n, cycles, omega)
> + local om4, om1 = omega*0.25, 1.0-omega
> + m = m - 1
> + n = n - 1
> + for i=1,cycles do
> + for y=2,m do
> + local v, vp, vn = mat[y], mat[y-1], mat[y+1]
> + for x=2,n do
> + v[x] = om4*((vp[x]+vn[x])+(v[x-1]+v[x+1])) + om1*v[x]
> + end
> + end
> + end
> +end
> +
> +function benchmarks.SOR(n)
> + local mat = random_matrix(n, n)
> + return function(cycles)
> + sor_run(mat, n, n, cycles, 1.25)
> + return (n-1)*(n-1)*cycles*6
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- MC: Monte Carlo Integration.
> +------------------------------------------------------------------------------
> +
> +local function mc_integrate(cycles)
> + local under_curve = 0
> + local rand = rand
> + for i=1,cycles do
> + local x = rand()
> + local y = rand()
> + if x*x + y*y <= 1.0 then under_curve = under_curve + 1 end
> + end
> + return (under_curve/cycles) * 4
> +end
> +
> +function benchmarks.MC()
> + return function(cycles)
> + local res = mc_integrate(cycles)
> + assert(math.sqrt(cycles)*math.abs(res-math.pi) < 5.0, "bad MC result")
> + return cycles * 4 -- Way off, but same as SciMark in C/Java.
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- Sparse Matrix Multiplication.
> +------------------------------------------------------------------------------
> +
> +local function sparse_mult(n, cycles, vy, val, row, col, vx)
> + for p=1,cycles do
> + for r=1,n do
> + local sum = 0
> + for i=row[r],row[r+1]-1 do sum = sum + vx[col[i]] * val[i] end
> + vy[r] = sum
> + end
> + end
> +end
> +
> +function benchmarks.SPARSE(n, nz)
> + local nr = floor(nz/n)
> + local anz = nr*n
> + local vx = random_vector(n)
> + local val = random_vector(anz)
> + local vy, col, row = darray(n+1), iarray(nz+1), iarray(n+2)
> + row[1] = 1
> + for r=1,n do
> + local step = floor(r/nr)
> + if step < 1 then step = 1 end
> + local rr = row[r]
> + row[r+1] = rr+nr
> + for i=0,nr-1 do col[rr+i] = 1+i*step end
> + end
> + return function(cycles)
> + sparse_mult(n, cycles, vy, val, row, col, vx)
> + return anz*cycles*2
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- LU: Dense Matrix Factorization.
> +------------------------------------------------------------------------------
> +
> +local function lu_factor(a, pivot, m, n)
> + local min_m_n = m < n and m or n
> + for j=1,min_m_n do
> + local jp, t = j, abs(a[j][j])
> + for i=j+1,m do
> + local ab = abs(a[i][j])
> + if ab > t then
> + jp = i
> + t = ab
> + end
> + end
> + pivot[j] = jp
> + if a[jp][j] == 0 then error("zero pivot") end
> + if jp ~= j then a[j], a[jp] = a[jp], a[j] end
> + if j < m then
> + local recp = 1.0 / a[j][j]
> + for k=j+1,m do
> + local v = a[k]
> + v[j] = v[j] * recp
> + end
> + end
> + if j < min_m_n then
> + for i=j+1,m do
> + local vi, vj = a[i], a[j]
> + local eij = vi[j]
> + for k=j+1,n do vi[k] = vi[k] - eij * vj[k] end
> + end
> + end
> + end
> +end
> +
> +local function matrix_alloc(m, n)
> + local a = {}
> + for y=1,m do a[y] = darray(n+1) end
> + return a
> +end
> +
> +local function matrix_copy(dst, src, m, n)
> + for y=1,m do
> + local vd, vs = dst[y], src[y]
> + for x=1,n do vd[x] = vs[x] end
> + end
> +end
> +
> +function benchmarks.LU(n)
> + local mat = random_matrix(n, n)
> + local tmp = matrix_alloc(n, n)
> + local pivot = iarray(n+1)
> + return function(cycles)
> + for i=1,cycles do
> + matrix_copy(tmp, mat, n, n)
> + lu_factor(tmp, pivot, n, n)
> + end
> + return 2.0/3.0*n*n*n*cycles
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- Main program.
> +------------------------------------------------------------------------------
> +
> +local function printf(...)
> + io.write(format(...))
> +end
> +
> +local function fmtparams(p1, p2)
> + if p2 then return format("[%d, %d]", p1, p2)
> + elseif p1 then return format("[%d]", p1) end
> + return ""
> +end
> +
> +local function measure(min_time, name, ...)
> + array_init()
> + rand_init(RANDOM_SEED)
> + local run = benchmarks[name](...)
> + local cycles = 1
> + repeat
> + local tm = clock()
> + local flops = run(cycles, ...)
> + tm = clock() - tm
> + if tm >= min_time then
> + local res = flops / tm * 1.0e-6
> + local p1, p2 = ...
> + printf("%-7s %8.2f %s\n", name, res, fmtparams(...))
> + return res
> + end
> + cycles = cycles * 2
> + until false
> +end
> +
> +printf("Lua SciMark %s based on SciMark 2.0a. %s.\n\n",
> + SCIMARK_VERSION, SCIMARK_COPYRIGHT)
> +
> +while arg and arg[1] do
> + local a = table.remove(arg, 1)
> + if a == "-noffi" then
> + package.preload.ffi = nil
> + elseif a == "-small" then
> + SIZE_SELECT = "small"
> + elseif a == "-large" then
> + SIZE_SELECT = "large"
> + elseif benchmarks[a] then
> + local p = benchmarks[SIZE_SELECT][a]
> + measure(MIN_TIME, a, tonumber(arg[1]) or p[1], tonumber(arg[2]) or p[2])
> + return
> + else
> + printf("Usage: scimark [-noffi] [-small|-large] [BENCH params...]\n\n")
> + printf("BENCH -small -large\n")
> + printf("---------------------------------------\n")
> + for _,name in ipairs(benchmarks) do
> + printf("%-7s %-13s %s\n", name,
> + fmtparams(unpack(benchmarks.small[name])),
> + fmtparams(unpack(benchmarks.large[name])))
> + end
> + printf("\n")
> + os.exit(1)
> + end
> +end
> +
> +local params = benchmarks[SIZE_SELECT]
> +local sum = 0
> +for _,name in ipairs(benchmarks) do
> + sum = sum + measure(MIN_TIME, name, unpack(params[name]))
> +end
> +printf("\nSciMark %8.2f [%s problem sizes]\n", sum / #benchmarks, SIZE_SELECT)
> +io.flush()
> +
> diff --git a/perf/LuaJIT-benches/scimark-fft.lua b/perf/LuaJIT-benches/scimark-fft.lua
> new file mode 100644
> index 00000000..c05bb69a
> --- /dev/null
> +++ b/perf/LuaJIT-benches/scimark-fft.lua
> @@ -0,0 +1 @@
> +require("scimark_lib").FFT(1024)(tonumber(arg and arg[1]) or 50000)
> diff --git a/perf/LuaJIT-benches/scimark-lu.lua b/perf/LuaJIT-benches/scimark-lu.lua
> new file mode 100644
> index 00000000..7636d994
> --- /dev/null
> +++ b/perf/LuaJIT-benches/scimark-lu.lua
> @@ -0,0 +1 @@
> +require("scimark_lib").LU(100)(tonumber(arg and arg[1]) or 5000)
> diff --git a/perf/LuaJIT-benches/scimark-sor.lua b/perf/LuaJIT-benches/scimark-sor.lua
> new file mode 100644
> index 00000000..e537e986
> --- /dev/null
> +++ b/perf/LuaJIT-benches/scimark-sor.lua
> @@ -0,0 +1 @@
> +require("scimark_lib").SOR(100)(tonumber(arg and arg[1]) or 50000)
> diff --git a/perf/LuaJIT-benches/scimark-sparse.lua b/perf/LuaJIT-benches/scimark-sparse.lua
> new file mode 100644
> index 00000000..01a2258d
> --- /dev/null
> +++ b/perf/LuaJIT-benches/scimark-sparse.lua
> @@ -0,0 +1 @@
> +require("scimark_lib").SPARSE(1000, 5000)(tonumber(arg and arg[1]) or 150000)
> diff --git a/perf/LuaJIT-benches/scimark_lib.lua b/perf/LuaJIT-benches/scimark_lib.lua
> new file mode 100644
> index 00000000..aeffd75a
> --- /dev/null
> +++ b/perf/LuaJIT-benches/scimark_lib.lua
> @@ -0,0 +1,297 @@
> +------------------------------------------------------------------------------
> +-- Lua SciMark (2010-03-15).
> +--
> +-- A literal translation of SciMark 2.0a, written in Java and C.
> +-- Credits go to the original authors Roldan Pozo and Bruce Miller.
> +-- See:http://math.nist.gov/scimark2/
> +------------------------------------------------------------------------------
> +
> +
> +local SCIMARK_VERSION = "2010-03-15"
> +
> +local RANDOM_SEED = 101009 -- Must be odd.
> +
> +local abs, log, sin, floor = math.abs, math.log, math.sin, math.floor
> +local pi, clock = math.pi, os.clock
> +
> +local benchmarks = {}
> +
> +------------------------------------------------------------------------------
> +-- This is a Lagged Fibonacci Pseudo-random Number Generator with
> +-- j, k, M = 5, 17, 31. Pretty weak, but same as C/Java SciMark.
> +------------------------------------------------------------------------------
> +
> +local rand, rand_init
> +
> +if jit and jit.status and jit.status() then
> + -- LJ2 has bit operations and zero-based arrays (internally).
> + local bit = require("bit")
> + local band, sar = bit.band, bit.arshift
> + local Rm, Rj, Ri = {}, 0, 0
> + for i=0,16 do Rm[i] = 0 end
> + function rand_init(seed)
> + Rj, Ri = 16, 11
> + for i=16,0,-1 do
> + seed = band(seed*9069, 0x7fffffff)
> + Rm[i] = seed
> + end
> + end
> + function rand()
> + local i = band(Ri+1, sar(Ri-16, 31))
> + local j = band(Rj+1, sar(Rj-16, 31))
> + Ri, Rj = i, j
> + local k = band(Rm[i] - Rm[j], 0x7fffffff)
> + Rm[j] = k
> + return k * (1.0/2147483647.0)
> + end
> +else
> + -- Better for standard Lua with one-based arrays and without bit operations.
> + local Rm, Rj = {}, 1
> + for i=1,17 do Rm[i] = 0 end
> + function rand_init(seed)
> + Rj = 1
> + for i=17,1,-1 do
> + seed = (seed*9069) % (2^31)
> + Rm[i] = seed
> + end
> + end
> + function rand()
> + local j, m = Rj, Rm
> + local h = j - 5
> + if h < 1 then h = h + 17 end
> + local k = m[h] - m[j]
> + if k < 0 then k = k + 2147483647 end
> + m[j] = k
> + if j < 17 then Rj = j + 1 else Rj = 1 end
> + return k * (1.0/2147483647.0)
> + end
> +end
> +
> +local function random_vector(n)
> + local v = {}
> + for x=1,n do v[x] = rand() end
> + return v
> +end
> +
> +local function random_matrix(m, n)
> + local a = {}
> + for y=1,m do
> + local v = {}
> + a[y] = v
> + for x=1,n do v[x] = rand() end
> + end
> + return a
> +end
> +
> +------------------------------------------------------------------------------
> +-- FFT: Fast Fourier Transform.
> +------------------------------------------------------------------------------
> +
> +local function fft_bitreverse(v, n)
> + local j = 0
> + for i=0,2*n-4,2 do
> + if i < j then
> + v[i+1], v[i+2], v[j+1], v[j+2] = v[j+1], v[j+2], v[i+1], v[i+2]
> + end
> + local k = n
> + while k <= j do j = j - k; k = k / 2 end
> + j = j + k
> + end
> +end
> +
> +local function fft_transform(v, n, dir)
> + if n <= 1 then return end
> + fft_bitreverse(v, n)
> + local dual = 1
> + repeat
> + local dual2 = 2*dual
> + for i=1,2*n-1,2*dual2 do
> + local j = i+dual2
> + local ir, ii = v[i], v[i+1]
> + local jr, ji = v[j], v[j+1]
> + v[j], v[j+1] = ir - jr, ii - ji
> + v[i], v[i+1] = ir + jr, ii + ji
> + end
> + local theta = dir * pi / dual
> + local s, s2 = sin(theta), 2.0 * sin(theta * 0.5)^2
> + local wr, wi = 1.0, 0.0
> + for a=3,dual2-1,2 do
> + wr, wi = wr - s*wi - s2*wr, wi + s*wr - s2*wi
> + for i=a,a+2*(n-dual2),2*dual2 do
> + local j = i+dual2
> + local jr, ji = v[j], v[j+1]
> + local dr, di = wr*jr - wi*ji, wr*ji + wi*jr
> + local ir, ii = v[i], v[i+1]
> + v[j], v[j+1] = ir - dr, ii - di
> + v[i], v[i+1] = ir + dr, ii + di
> + end
> + end
> + dual = dual2
> + until dual >= n
> +end
> +
> +function benchmarks.FFT(n)
> + local l2n = log(n)/log(2)
> + if l2n % 1 ~= 0 then
> +io.stderr:write("Error: FFT data length is not a power of 2\n")
> + os.exit(1)
> + end
> + local v = random_vector(n*2)
> + return function(cycles)
> + local norm = 1.0 / n
> + for p=1,cycles do
> + fft_transform(v, n, -1)
> + fft_transform(v, n, 1)
> + for i=1,n*2 do v[i] = v[i] * norm end
> + end
> + return ((5*n-2)*l2n + 2*(n+1)) * cycles
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- SOR: Jacobi Successive Over-Relaxation.
> +------------------------------------------------------------------------------
> +
> +local function sor_run(mat, m, n, cycles, omega)
> + local om4, om1 = omega*0.25, 1.0-omega
> + m = m - 1
> + n = n - 1
> + for i=1,cycles do
> + for y=2,m do
> + local v, vp, vn = mat[y], mat[y-1], mat[y+1]
> + for x=2,n do
> + v[x] = om4*((vp[x]+vn[x])+(v[x-1]+v[x+1])) + om1*v[x]
> + end
> + end
> + end
> +end
> +
> +function benchmarks.SOR(n)
> + local mat = random_matrix(n, n)
> + return function(cycles)
> + sor_run(mat, n, n, cycles, 1.25)
> + return (n-1)*(n-1)*cycles*6
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- MC: Monte Carlo Integration.
> +------------------------------------------------------------------------------
> +
> +local function mc_integrate(cycles)
> + local under_curve = 0
> + local rand = rand
> + for i=1,cycles do
> + local x = rand()
> + local y = rand()
> + if x*x + y*y <= 1.0 then under_curve = under_curve + 1 end
> + end
> + return (under_curve/cycles) * 4
> +end
> +
> +function benchmarks.MC()
> + return function(cycles)
> + local res = mc_integrate(cycles)
> + assert(math.sqrt(cycles)*math.abs(res-math.pi) < 5.0, "bad MC result")
> + return cycles * 4 -- Way off, but same as SciMark in C/Java.
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- Sparse Matrix Multiplication.
> +------------------------------------------------------------------------------
> +
> +local function sparse_mult(n, cycles, vy, val, row, col, vx)
> + for p=1,cycles do
> + for r=1,n do
> + local sum = 0
> + for i=row[r],row[r+1]-1 do sum = sum + vx[col[i]] * val[i] end
> + vy[r] = sum
> + end
> + end
> +end
> +
> +function benchmarks.SPARSE(n, nz)
> + local nr = floor(nz/n)
> + local anz = nr*n
> + local vx = random_vector(n)
> + local val = random_vector(anz)
> + local vy, col, row = {}, {}, {}
> + row[1] = 1
> + for r=1,n do
> + local step = floor(r/nr)
> + if step < 1 then step = 1 end
> + local rr = row[r]
> + row[r+1] = rr+nr
> + for i=0,nr-1 do col[rr+i] = 1+i*step end
> + end
> + return function(cycles)
> + sparse_mult(n, cycles, vy, val, row, col, vx)
> + return anz*cycles*2
> + end
> +end
> +
> +------------------------------------------------------------------------------
> +-- LU: Dense Matrix Factorization.
> +------------------------------------------------------------------------------
> +
> +local function lu_factor(a, pivot, m, n)
> + local min_m_n = m < n and m or n
> + for j=1,min_m_n do
> + local jp, t = j, abs(a[j][j])
> + for i=j+1,m do
> + local ab = abs(a[i][j])
> + if ab > t then
> + jp = i
> + t = ab
> + end
> + end
> + pivot[j] = jp
> + if a[jp][j] == 0 then error("zero pivot") end
> + if jp ~= j then a[j], a[jp] = a[jp], a[j] end
> + if j < m then
> + local recp = 1.0 / a[j][j]
> + for k=j+1,m do
> + local v = a[k]
> + v[j] = v[j] * recp
> + end
> + end
> + if j < min_m_n then
> + for i=j+1,m do
> + local vi, vj = a[i], a[j]
> + local eij = vi[j]
> + for k=j+1,n do vi[k] = vi[k] - eij * vj[k] end
> + end
> + end
> + end
> +end
> +
> +local function matrix_alloc(m, n)
> + local a = {}
> + for y=1,m do a[y] = {} end
> + return a
> +end
> +
> +local function matrix_copy(dst, src, m, n)
> + for y=1,m do
> + local vd, vs = dst[y], src[y]
> + for x=1,n do vd[x] = vs[x] end
> + end
> +end
> +
> +function benchmarks.LU(n)
> + local mat = random_matrix(n, n)
> + local tmp = matrix_alloc(n, n)
> + local pivot = {}
> + return function(cycles)
> + for i=1,cycles do
> + matrix_copy(tmp, mat, n, n)
> + lu_factor(tmp, pivot, n, n)
> + end
> + return 2.0/3.0*n*n*n*cycles
> + end
> +end
> +
> +rand_init(RANDOM_SEED)
> +
> +return benchmarks
> diff --git a/perf/LuaJIT-benches/series.lua b/perf/LuaJIT-benches/series.lua
> new file mode 100644
> index 00000000..f766cb32
> --- /dev/null
> +++ b/perf/LuaJIT-benches/series.lua
> @@ -0,0 +1,34 @@
> +
> +local function integrate(x0, x1, nsteps, omegan, f)
> + local x, dx = x0, (x1-x0)/nsteps
> + local rvalue = ((x0+1)^x0 * f(omegan*x0)) / 2
> + for i=3,nsteps do
> + x = x + dx
> + rvalue = rvalue + (x+1)^x * f(omegan*x)
> + end
> + return (rvalue + ((x1+1)^x1 * f(omegan*x1)) / 2) * dx
> +end
> +
> +local function series(n)
> + local sin, cos = math.sin, math.cos
> + local omega = math.pi
> + local t = {}
> +
> + t[1] = integrate(0, 2, 1000, 0, function() return 1 end) / 2
> + t[2] = 0
> +
> + for i=2,n do
> + t[2*i-1] = integrate(0, 2, 1000, omega*i, cos)
> + t[2*i] = integrate(0, 2, 1000, omega*i, sin)
> + end
> +
> + return t
> +end
> +
> +local n = tonumber(arg and arg[1]) or 10000
> +local tm = os.clock()
> +local t = series(n)
> +tm = os.clock() - tm
> +assert(math.abs(t[1]-2.87295) < 0.00001)
> +io.write(string.format("size %d, %.2f s, %.1f iterations/s\n",
> + n, tm, (2*n-1)/tm))
> diff --git a/perf/LuaJIT-benches/spectral-norm.lua b/perf/LuaJIT-benches/spectral-norm.lua
> new file mode 100644
> index 00000000..ecc80112
> --- /dev/null
> +++ b/perf/LuaJIT-benches/spectral-norm.lua
> @@ -0,0 +1,40 @@
> +
> +local function A(i, j)
> + local ij = i+j-1
> + return 1.0 / (ij * (ij-1) * 0.5 + i)
> +end
> +
> +local function Av(x, y, N)
> + for i=1,N do
> + local a = 0
> + for j=1,N do a = a + x[j] * A(i, j) end
> + y[i] = a
> + end
> +end
> +
> +local function Atv(x, y, N)
> + for i=1,N do
> + local a = 0
> + for j=1,N do a = a + x[j] * A(j, i) end
> + y[i] = a
> + end
> +end
> +
> +local function AtAv(x, y, t, N)
> + Av(x, t, N)
> + Atv(t, y, N)
> +end
> +
> +local N = tonumber(arg and arg[1]) or 100
> +local u, v, t = {}, {}, {}
> +for i=1,N do u[i] = 1 end
> +
> +for i=1,10 do AtAv(u, v, t, N) AtAv(v, u, t, N) end
> +
> +local vBv, vv = 0, 0
> +for i=1,N do
> + local ui, vi = u[i], v[i]
> + vBv = vBv + ui*vi
> + vv = vv + vi*vi
> +end
> +io.write(string.format("%0.9f\n", math.sqrt(vBv / vv)))
> diff --git a/perf/LuaJIT-benches/sum-file.lua b/perf/LuaJIT-benches/sum-file.lua
> new file mode 100644
> index 00000000..c9e618fd
> --- /dev/null
> +++ b/perf/LuaJIT-benches/sum-file.lua
> @@ -0,0 +1,6 @@
> +
> +local sum = 0
> +for line in io.lines() do
> + sum = sum + line
> +end
> +io.write(sum, "\n")
[-- Attachment #2: Type: text/html, Size: 91176 bytes --]
next prev parent reply other threads:[~2025-12-29 13:29 UTC|newest]
Thread overview: 50+ messages / expand[flat|nested] mbox.gz Atom feed top
2025-12-26 9:17 [Tarantool-patches] [PATCH v2 luajit 00/41] LuaJIT performance testing Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 01/41] perf: add LuaJIT-test-cleanup perf suite Sergey Kaplun via Tarantool-patches
2025-12-29 13:28 ` Sergey Bronnikov via Tarantool-patches [this message]
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 02/41] perf: introduce clock module Sergey Kaplun via Tarantool-patches
2025-12-29 13:55 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 03/41] perf: introduce bench module Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 04/41] perf: adjust array3d in LuaJIT-benches Sergey Kaplun via Tarantool-patches
2025-12-29 14:00 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 05/41] perf: adjust binary-trees " Sergey Kaplun via Tarantool-patches
2025-12-29 14:04 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 06/41] perf: adjust chameneos " Sergey Kaplun via Tarantool-patches
2025-12-29 14:18 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 07/41] perf: adjust coroutine-ring " Sergey Kaplun via Tarantool-patches
2025-12-29 14:10 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 08/41] perf: adjust euler14-bit " Sergey Kaplun via Tarantool-patches
2025-12-29 14:15 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 09/41] perf: adjust fannkuch " Sergey Kaplun via Tarantool-patches
2025-12-29 14:17 ` Sergey Bronnikov via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 10/41] perf: adjust fasta " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 11/41] perf: adjust k-nucleotide " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 12/41] perf: adjust life " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 13/41] perf: adjust mandelbrot-bit " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 14/41] perf: adjust mandelbrot " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 15/41] perf: adjust md5 " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 16/41] perf: adjust meteor " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 17/41] perf: adjust nbody " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 18/41] perf: adjust nsieve-bit-fp " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 19/41] perf: adjust nsieve-bit " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 20/41] perf: adjust nsieve " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 21/41] perf: adjust partialsums " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 22/41] perf: adjust pidigits-nogmp " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 23/41] perf: adjust ray " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 24/41] perf: adjust recursive-ack " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 25/41] perf: adjust recursive-fib " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 26/41] perf: adjust revcomp " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 27/41] perf: adjust scimark-2010-12-20 " Sergey Kaplun via Tarantool-patches
2025-12-26 9:17 ` [Tarantool-patches] [PATCH v2 luajit 28/41] perf: move <scimark_lib.lua> to <libs/> directory Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 29/41] perf: adjust scimark-fft in LuaJIT-benches Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 30/41] perf: adjust scimark-lu " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 31/41] perf: add scimark-mc " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 32/41] perf: adjust scimark-sor " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 33/41] perf: adjust scimark-sparse " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 34/41] perf: adjust series " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 35/41] perf: adjust spectral-norm " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 36/41] perf: adjust sum-file " Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 37/41] perf: add CMake infrastructure Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 38/41] perf: add aggregator helper for bench statistics Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 39/41] perf: add a script for the environment setup Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 40/41] perf: provide CMake option to setup the benchmark Sergey Kaplun via Tarantool-patches
2025-12-26 9:18 ` [Tarantool-patches] [PATCH v2 luajit 41/41] ci: introduce the performance workflow Sergey Kaplun via Tarantool-patches
Reply instructions:
You may reply publicly to this message via plain-text email
using any one of the following methods:
* Save the following mbox file, import it into your mail client,
and reply-to-all from there: mbox
Avoid top-posting and favor interleaved quoting:
https://en.wikipedia.org/wiki/Posting_style#Interleaved_style
* Reply using the --to, --cc, and --in-reply-to
switches of git-send-email(1):
git send-email \
--in-reply-to=ffda497d-fe6d-4a56-a833-ff8c1502ea85@tarantool.org \
--to=tarantool-patches@dev.tarantool.org \
--cc=sergeyb@tarantool.org \
--cc=skaplun@tarantool.org \
--subject='Re: [Tarantool-patches] [PATCH v2 luajit 01/41] perf: add LuaJIT-test-cleanup perf suite' \
/path/to/YOUR_REPLY
https://kernel.org/pub/software/scm/git/docs/git-send-email.html
* If your mail client supports setting the In-Reply-To header
via mailto: links, try the mailto: link
This is a public inbox, see mirroring instructions
for how to clone and mirror all data and code used for this inbox