Re: [Tarantool-patches] [PATCH v1 luajit 10/41] perf: adjust fasta in LuaJIT-benches

[Sergey Bronnikov via Tarantool-patches <tarantool-patches@dev.tarantool.org>]

[-- Attachment #1: Type: text/plain, Size: 8107 bytes --]

Hello,

thanks for the patch! See my comments.

Sergey

On 10/24/25 13:50, Sergey Kaplun wrote:
> This patch adjusts the aforementioned test to use the benchmark
> framework introduced before. The default arguments are adjusted
> according to the <PARAM_x86.txt> file. The arguments to the script still
> can be provided in the command line run.
>
> Since the result output (with the different input parameter value)
> produced by this benchmark is used in other benchmarks
> (<k-nucleotide.lua> and <revcomp.lua>), the original script is used as a
> library (inside the <libs/> subdirectory) with the updated default input
> value and returns the number of items processed. The output for the
> benchmark itself is suppressed and not checked since it is irrational to
> store in the repository such huge files for testing.
> ---
>   perf/LuaJIT-benches/fasta.lua      | 120 +++++++----------------------
>   perf/LuaJIT-benches/libs/fasta.lua |  98 +++++++++++++++++++++++
>   2 files changed, 125 insertions(+), 93 deletions(-)
>   create mode 100644 perf/LuaJIT-benches/libs/fasta.lua
>
> diff --git a/perf/LuaJIT-benches/fasta.lua b/perf/LuaJIT-benches/fasta.lua
> index 7ce60804..d0dc005d 100644
> --- a/perf/LuaJIT-benches/fasta.lua
> +++ b/perf/LuaJIT-benches/fasta.lua
> @@ -1,95 +1,29 @@
> -
> -local Last = 42
> -local function random(max)
> -  local y = (Last * 3877 + 29573) % 139968
> -  Last = y
> -  return (max * y) / 139968
> -end
> -
> -local function make_repeat_fasta(id, desc, s, n)
> -  local write, sub = io.write, string.sub
> -  write(">", id, " ", desc, "\n")
> -  local p, sn, s2 = 1, #s, s..s
> -  for i=60,n,60 do
> -    write(sub(s2, p, p + 59), "\n")
> -    p = p + 60; if p > sn then p = p - sn end
> -  end
> -  local tail = n % 60
> -  if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
> -end
> -
> -local function make_random_fasta(id, desc, bs, n)
> -  io.write(">", id, " ", desc, "\n")
> -  loadstring([=[
> -    local write, char, unpack, n, random = io.write, string.char, unpack, ...
> -    local buf, p = {}, 1
> -    for i=60,n,60 do
> -      for j=p,p+59 do ]=]..bs..[=[ end
> -      buf[p+60] = 10; p = p + 61
> -      if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
> -    end
> -    local tail = n % 60
> -    if tail > 0 then
> -      for j=p,p+tail-1 do ]=]..bs..[=[ end
> -      p = p + tail; buf[p] = 10; p = p + 1
> -    end
> -    write(char(unpack(buf, 1, p-1)))
> -  ]=], desc)(n, random)
> -end
> -
> -local function bisect(c, p, lo, hi)
> -  local n = hi - lo
> -  if n == 0 then return "buf[j] = "..c[hi].."\n" end
> -  local mid = math.floor(n / 2)
> -  return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
> -         "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
> -end
> -
> -local function make_bisect(tab)
> -  local c, p, sum = {}, {}, 0
> -  for i,row in ipairs(tab) do
> -    c[i] = string.byte(row[1])
> -    sum = sum + row[2]
> -    p[i] = sum
> -  end
> -  return "local r = random(1)\n"..bisect(c, p, 1, #tab)
> -end
> -
> -local alu =
> -  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
> -  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
> -  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
> -  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
> -  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
> -  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
> -  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
> -
> -local iub = make_bisect{
> -  { "a", 0.27 },
> -  { "c", 0.12 },
> -  { "g", 0.12 },
> -  { "t", 0.27 },
> -  { "B", 0.02 },
> -  { "D", 0.02 },
> -  { "H", 0.02 },
> -  { "K", 0.02 },
> -  { "M", 0.02 },
> -  { "N", 0.02 },
> -  { "R", 0.02 },
> -  { "S", 0.02 },
> -  { "V", 0.02 },
> -  { "W", 0.02 },
> -  { "Y", 0.02 },
> -}
> -
> -local homosapiens = make_bisect{
> -  { "a", 0.3029549426680 },
> -  { "c", 0.1979883004921 },
> -  { "g", 0.1975473066391 },
> -  { "t", 0.3015094502008 },
> +local bench = require("bench").new(arg)
> +
> +local stdout = io.output()
> +
> +local benchmark
> +benchmark = {
> +  name = "fasta",
> +  -- XXX: The result file may take up to 278 Mb for the default
> +  -- settings. To check the correctness of the script, run it as
> +  -- is from the console.
> +  skip_check = true,
> +  setup = function()
> +    io.output("/dev/null")
> +  end,
> +  payload = function()
> +    -- Run the benchmark as is from the file.
> +    local items = require("fasta")
> +    -- Remove it from the cache to be sure the benchmark will run
> +    -- at the next iteration.
> +    package.loaded["fasta"] = nil
> +    benchmark.items = items
> +  end,
> +  teardown = function()
> +    io.output(stdout)
> +  end,
>   }
>   
> -local N = tonumber(arg and arg[1]) or 1000
> -make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
> -make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
> -make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
> +bench:add(benchmark)
> +bench:run_and_report()
> diff --git a/perf/LuaJIT-benches/libs/fasta.lua b/perf/LuaJIT-benches/libs/fasta.lua
> new file mode 100644
> index 00000000..9c72c244
> --- /dev/null
> +++ b/perf/LuaJIT-benches/libs/fasta.lua
> @@ -0,0 +1,98 @@
> +
> +local Last = 42
> +local function random(max)
> +  local y = (Last * 3877 + 29573) % 139968
> +  Last = y
> +  return (max * y) / 139968
> +end
> +
> +local function make_repeat_fasta(id, desc, s, n)
> +  local write, sub = io.write, string.sub
> +  write(">", id, " ", desc, "\n")
> +  local p, sn, s2 = 1, #s, s..s
> +  for i=60,n,60 do
more whitespaces please
> +    write(sub(s2, p, p + 59), "\n")
> +    p = p + 60; if p > sn then p = p - sn end
> +  end
> +  local tail = n % 60
> +  if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
more whitespaces please. Here and below.
> +end
> +
> +local function make_random_fasta(id, desc, bs, n)
> +  io.write(">", id, " ", desc, "\n")
> +  loadstring([=[
> +    local write, char, unpack, n, random = io.write, string.char, unpack, ...
> +    local buf, p = {}, 1
> +    for i=60,n,60 do
> +      for j=p,p+59 do ]=]..bs..[=[ end
> +      buf[p+60] = 10; p = p + 61
> +      if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
> +    end
> +    local tail = n % 60
> +    if tail > 0 then
> +      for j=p,p+tail-1 do ]=]..bs..[=[ end
> +      p = p + tail; buf[p] = 10; p = p + 1
> +    end
> +    write(char(unpack(buf, 1, p-1)))
> +  ]=], desc)(n, random)
> +end
> +
> +local function bisect(c, p, lo, hi)
> +  local n = hi - lo
> +  if n == 0 then return "buf[j] = "..c[hi].."\n" end
> +  local mid = math.floor(n / 2)
> +  return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
> +         "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
> +end
> +
> +local function make_bisect(tab)
> +  local c, p, sum = {}, {}, 0
> +  for i,row in ipairs(tab) do
> +    c[i] = string.byte(row[1])
> +    sum = sum + row[2]
> +    p[i] = sum
> +  end
> +  return "local r = random(1)\n"..bisect(c, p, 1, #tab)
> +end
> +
> +local alu =
> +  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
> +  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
> +  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
> +  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
> +  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
> +  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
> +  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
> +
> +local iub = make_bisect{
> +  { "a", 0.27 },
> +  { "c", 0.12 },
> +  { "g", 0.12 },
> +  { "t", 0.27 },
> +  { "B", 0.02 },
> +  { "D", 0.02 },
> +  { "H", 0.02 },
> +  { "K", 0.02 },
> +  { "M", 0.02 },
> +  { "N", 0.02 },
> +  { "R", 0.02 },
> +  { "S", 0.02 },
> +  { "V", 0.02 },
> +  { "W", 0.02 },
> +  { "Y", 0.02 },
> +}
> +
> +local homosapiens = make_bisect{
> +  { "a", 0.3029549426680 },
> +  { "c", 0.1979883004921 },
> +  { "g", 0.1975473066391 },
> +  { "t", 0.3015094502008 },
> +}
> +
> +local N = tonumber(arg and arg[1]) or 25e6
> +
> +make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
> +make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
> +make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
> +
> +return N*2 + N*3 + N*5

[-- Attachment #2: Type: text/html, Size: 8537 bytes --]