<!DOCTYPE html>
<html data-lt-installed="true">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
</head>
<body style="padding-bottom: 1px;">
<p>Hi, Sergey,</p>
<p>Thanks for the patch! LGTM</p>
<p>Sergey</p>
<div class="moz-cite-prefix">On 12/26/25 12:17, Sergey Kaplun wrote:<br>
</div>
<blockquote type="cite"
cite="mid:9e98c600fdd28246ef80da1988866e5948a6ba62.1766738771.git.skaplun@tarantool.org">
<pre wrap="" class="moz-quote-pre">This patch adjusts the aforementioned test to use the benchmark
framework introduced before. The default arguments are adjusted
according to the <PARAM_x86.txt> file. The arguments to the script still
can be provided in the command line run.
Since the result output (with the different input parameter value)
produced by this benchmark is used in other benchmarks
(<k-nucleotide.lua> and <revcomp.lua>), the original script is used as a
library (inside the <libs/> subdirectory) with the updated default input
value and returns the number of items processed. The output for the
benchmark itself is suppressed and not checked since it is irrational to
store in the repository such huge files for testing.
---
perf/LuaJIT-benches/fasta.lua | 126 ++++++++---------------------
perf/LuaJIT-benches/libs/fasta.lua | 105 ++++++++++++++++++++++++
2 files changed, 138 insertions(+), 93 deletions(-)
create mode 100644 perf/LuaJIT-benches/libs/fasta.lua
diff --git a/perf/LuaJIT-benches/fasta.lua b/perf/LuaJIT-benches/fasta.lua
index 7ce60804..457623b2 100644
--- a/perf/LuaJIT-benches/fasta.lua
+++ b/perf/LuaJIT-benches/fasta.lua
@@ -1,95 +1,35 @@
-
-local Last = 42
-local function random(max)
- local y = (Last * 3877 + 29573) % 139968
- Last = y
- return (max * y) / 139968
-end
-
-local function make_repeat_fasta(id, desc, s, n)
- local write, sub = io.write, string.sub
- write(">", id, " ", desc, "\n")
- local p, sn, s2 = 1, #s, s..s
- for i=60,n,60 do
- write(sub(s2, p, p + 59), "\n")
- p = p + 60; if p > sn then p = p - sn end
- end
- local tail = n % 60
- if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
-end
-
-local function make_random_fasta(id, desc, bs, n)
- io.write(">", id, " ", desc, "\n")
- loadstring([=[
- local write, char, unpack, n, random = io.write, string.char, unpack, ...
- local buf, p = {}, 1
- for i=60,n,60 do
- for j=p,p+59 do ]=]..bs..[=[ end
- buf[p+60] = 10; p = p + 61
- if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
- end
- local tail = n % 60
- if tail > 0 then
- for j=p,p+tail-1 do ]=]..bs..[=[ end
- p = p + tail; buf[p] = 10; p = p + 1
- end
- write(char(unpack(buf, 1, p-1)))
- ]=], desc)(n, random)
-end
-
-local function bisect(c, p, lo, hi)
- local n = hi - lo
- if n == 0 then return "buf[j] = "..c[hi].."\n" end
- local mid = math.floor(n / 2)
- return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
- "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
-end
-
-local function make_bisect(tab)
- local c, p, sum = {}, {}, 0
- for i,row in ipairs(tab) do
- c[i] = string.byte(row[1])
- sum = sum + row[2]
- p[i] = sum
- end
- return "local r = random(1)\n"..bisect(c, p, 1, #tab)
-end
-
-local alu =
- "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
- "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
- "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
- "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
- "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
- "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
- "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-local iub = make_bisect{
- { "a", 0.27 },
- { "c", 0.12 },
- { "g", 0.12 },
- { "t", 0.27 },
- { "B", 0.02 },
- { "D", 0.02 },
- { "H", 0.02 },
- { "K", 0.02 },
- { "M", 0.02 },
- { "N", 0.02 },
- { "R", 0.02 },
- { "S", 0.02 },
- { "V", 0.02 },
- { "W", 0.02 },
- { "Y", 0.02 },
-}
-
-local homosapiens = make_bisect{
- { "a", 0.3029549426680 },
- { "c", 0.1979883004921 },
- { "g", 0.1975473066391 },
- { "t", 0.3015094502008 },
+-- Benchmark to check the performance of working with strings and
+-- output to the file. It generates DNA sequences by copying or
+-- weighted random selection.
+-- For details see:
+-- <a class="moz-txt-link-freetext" href="https://benchmarksgame-team.pages.debian.net/benchmarksgame/description/fasta.html">https://benchmarksgame-team.pages.debian.net/benchmarksgame/description/fasta.html</a>
+
+local bench = require("bench").new(arg)
+
+local stdout = io.output()
+
+local benchmark
+benchmark = {
+ name = "fasta",
+ -- XXX: The result file may take up to 278 Mb for the default
+ -- settings. To check the correctness of the script, run it as
+ -- is from the console.
+ skip_check = true,
+ setup = function()
+ io.output("/dev/null")
+ end,
+ payload = function()
+ -- Run the benchmark as is from the file.
+ local items = require("fasta")
+ -- Remove it from the cache to be sure the benchmark will run
+ -- at the next iteration.
+ package.loaded["fasta"] = nil
+ benchmark.items = items
+ end,
+ teardown = function()
+ io.output(stdout)
+ end,
}
-local N = tonumber(arg and arg[1]) or 1000
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
+bench:add(benchmark)
+bench:run_and_report()
diff --git a/perf/LuaJIT-benches/libs/fasta.lua b/perf/LuaJIT-benches/libs/fasta.lua
new file mode 100644
index 00000000..58f59dd5
--- /dev/null
+++ b/perf/LuaJIT-benches/libs/fasta.lua
@@ -0,0 +1,105 @@
+-- Benchmark to check the performance of working with strings and
+-- output to the file. It generates DNA sequences by copying or
+-- weighted random selection.
+-- For details see:
+-- <a class="moz-txt-link-freetext" href="https://benchmarksgame-team.pages.debian.net/benchmarksgame/description/fasta.html">https://benchmarksgame-team.pages.debian.net/benchmarksgame/description/fasta.html</a>
+-- Also, this file is used as a script to generate inputs for
+-- other benchmarks like <k-nucleotide.lua> and <revcomp.lua>.
+
+local Last = 42
+local function random(max)
+ local y = (Last * 3877 + 29573) % 139968
+ Last = y
+ return (max * y) / 139968
+end
+
+local function make_repeat_fasta(id, desc, s, n)
+ local write, sub = io.write, string.sub
+ write(">", id, " ", desc, "\n")
+ local p, sn, s2 = 1, #s, s..s
+ for i = 60, n, 60 do
+ write(sub(s2, p, p + 59), "\n")
+ p = p + 60; if p > sn then p = p - sn end
+ end
+ local tail = n % 60
+ if tail > 0 then write(sub(s2, p, p + tail - 1), "\n") end
+end
+
+local function make_random_fasta(id, desc, bs, n)
+ io.write(">", id, " ", desc, "\n")
+ loadstring([=[
+ local write, char, unpack, n, random = io.write, string.char, unpack, ...
+ local buf, p = {}, 1
+ for i = 60, n, 60 do
+ for j = p, p + 59 do ]=]..bs..[=[ end
+ buf[p + 60] = 10; p = p + 61
+ if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
+ end
+ local tail = n % 60
+ if tail > 0 then
+ for j = p, p + tail - 1 do ]=]..bs..[=[ end
+ p = p + tail; buf[p] = 10; p = p + 1
+ end
+ write(char(unpack(buf, 1, p - 1)))
+ ]=], desc)(n, random)
+end
+
+local function bisect(c, p, lo, hi)
+ local n = hi - lo
+ if n == 0 then return "buf[j] = "..c[hi].."\n" end
+ local mid = math.floor(n / 2)
+ return "if r < "..p[lo + mid].." then\n"..bisect(c, p, lo, lo + mid)..
+ "else\n"..bisect(c, p, lo + mid + 1, hi).."end\n"
+end
+
+local function make_bisect(tab)
+ local c, p, sum = {}, {}, 0
+ for i, row in ipairs(tab) do
+ c[i] = string.byte(row[1])
+ sum = sum + row[2]
+ p[i] = sum
+ end
+ return "local r = random(1)\n"..bisect(c, p, 1, #tab)
+end
+
+local alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+local iub = make_bisect{
+ { "a", 0.27 },
+ { "c", 0.12 },
+ { "g", 0.12 },
+ { "t", 0.27 },
+ { "B", 0.02 },
+ { "D", 0.02 },
+ { "H", 0.02 },
+ { "K", 0.02 },
+ { "M", 0.02 },
+ { "N", 0.02 },
+ { "R", 0.02 },
+ { "S", 0.02 },
+ { "V", 0.02 },
+ { "W", 0.02 },
+ { "Y", 0.02 },
+}
+
+local homosapiens = make_bisect{
+ { "a", 0.3029549426680 },
+ { "c", 0.1979883004921 },
+ { "g", 0.1975473066391 },
+ { "t", 0.3015094502008 },
+}
+
+local N = tonumber(arg and arg[1]) or 25e6
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
+
+return N*2 + N*3 + N*5
</pre>
</blockquote>
</body>
<lt-container></lt-container>
</html>